Rhodococcus jostii RHA1: Advanced Genome Editing of the PET Hydrolase for Bioremediation and Biocatalysis

Abstract

This article provides a comprehensive guide for researchers and biotechnologists on the genome editing of Rhodococcus jostii RHA1, with a focus on engineering its polyethylene terephthalate (PET) hydrolase (RPET). We cover the foundational biology of RHA1 and its PET-degrading enzymes, detail modern CRISPR/Cas9 and homologous recombination methodologies, address common troubleshooting and optimization challenges in this non-model actinobacterium, and validate strategies through comparative analysis of editing efficiency and phenotypic outcomes. The aim is to equip scientists with the knowledge to harness RHA1's robust metabolism for environmental and synthetic biology applications.

Understanding Rhodococcus jostii RHA1: Biology, Enzymes, and Genetic Potential

This whitepaper details the foundational catabolic platform of Rhodococcus jostii RHA1, a soil-dwelling actinobacterium. The organism's intrinsic metabolic versatility is the cornerstone of the broader thesis research, which aims to engineer R. jostii for polyethylene terephthalate (PET) depolymerization via targeted RPET genome editing. RHA1's extensive repertoire of catabolic enzymes, encoded on its linear megaplasmids and large chromosome, provides the necessary genetic and biochemical chassis for constructing efficient whole-cell biocatalysts for plastic waste valorization.

Genomic and Metabolic Architecture

R. jostii RHA1 possesses one of the largest bacterial genomes (9.7 Mbp), distributed across a chromosome and three large linear plasmids (pRHL1, pRHL2, pRHL3). This genetic expanse directly underpins its catabolic prowess.

Table 1: Genomic Organization of R. jostii RHA1

Genomic Element	Size (Mbp)	Key Catabolic Gene Clusters	Primary Metabolic Roles
Chromosome	7.8	Central aromatic pathways (β-ketoadipate), lipid metabolism	Core metabolism, regulation
Plasmid pRHL1	1.1	Biphenyl/PCB degradation (bph genes)	Aromatic hydrocarbon catabolism
Plasmid pRHL2	0.44	Benzoate degradation (box genes)	Aromatic acid degradation
Plasmid pRHL3	0.33	Ethane-1,2-diol utilization	Short-chain diol metabolism

Core Catabolic Pathways: Quantitative Analysis

A live search of recent literature confirms RHA1's documented capacity to degrade over 200 aromatic and aliphatic compounds. Key pathway metrics are summarized below.

Table 2: Quantitative Metrics of Key Catabolic Pathways in RHA1

Pathway/Substrate	Key Enzymes	Estimated Number of Genes	Reported Degradation Rate*	Relevance to PET Upcycling
Biphenyl/PCBs	Biphenyl dioxygenase (BphA), Dihydrodiol dehydrogenase (BphB)	>20 gene cluster	0.8 μmol/min/mg protein (BphA)	Ring-cleavage logic for terephthalate
Lignin-derived aromatics	Protocatechuate 3,4-dioxygenase (PcaGH)	~15 gene cluster	120 nmol/min/mg protein (PcaGH)	Catechol dioxygenase homologs
Alkanes (C10-C30)	Alkane monooxygenase (AlkB)	Multiple paralogs	35 nmol/min/mg cell dry weight	Potential side-chain metabolism
Ethane-1,2-diol	Alcohol dehydrogenase, Glycolaldehyde oxidoreductase	~10 gene cluster	N/A	Ethylene glycol catabolism
Benzoate/Terephthalate	Benzoate dioxygenase (BenA), Terephthalate dioxygenase (TPA-dioxygenase)	~15 gene cluster	45 nmol/min/mg protein (TPA-dioxygenase)	Direct PET monomer degradation

*Rates are representative from cited literature and may vary with conditions.

Experimental Protocols for Catabolic Analysis

Protocol 1: Assaying Aromatic Ring-Cleaving Dioxygenase Activity

• Principle: Measure the formation of ring-cleavage products (e.g., 2-hydroxy-6-oxohepta-2,4-dienoate) by increase in absorbance at ~375 nm.
• Procedure:
  • Cell Lysate Preparation: Grow RHA1 on target substrate (e.g., benzoate). Harvest cells, resuspend in 50 mM Tris-HCl (pH 7.5), and disrupt by sonication. Centrifuge (15,000 x g, 30 min, 4°C) to obtain clear supernatant.
  • Reaction Setup: In a quartz cuvette, mix 880 μL of 50 mM Tris-HCl (pH 7.5), 50 μL of cell extract, and 50 μL of substrate (e.g., 10 mM catechol or protocatechuate in buffer).
  • Measurement: Immediately place in spectrophotometer. Record increase in A₃₇₅ for 3 minutes against a blank (substrate omitted).
  • Calculation: Activity (nmol/min/mg protein) = (ΔA₃₇₅/min * Vtotal * 10⁶) / (ε * Venz * protein_conc), where ε is the molar extinction coefficient of the product (e.g., ~13,000 M⁻¹cm⁻¹ for meta-cleavage product).

Protocol 2: Growth Phenotyping on Carbon Source Arrays

• Principle: Use Biolog Phenotype MicroArray plates (e.g., PM1, PM2A) or custom minimal media plates to quantitatively assess RHA1's catabolic breadth.
• Procedure:
  • Inoculum Prep: Grow RHA1 in rich medium (LB), wash 2x with minimal salts medium (MSM) without carbon source.
  • Plate Inoculation: Resuspend cells in MSM + tetrazolium dye (e.g., Biolog Redox Dye D). Dispense 100 μL/well into 96-well plate containing different carbon sources.
  • Incubation & Reading: Incubate at 30°C in a plate reader. Monitor reduction of tetrazolium dye (color change) by measuring A₅₉₀ every 15 minutes for 48-72 hours.
  • Analysis: Calculate area under the curve (AUC) for each well. Normalize to positive (succinate) and negative (no carbon) controls. AUC > 50% of positive control indicates positive utilization.

Visualizing Catabolic Logic and Engineering Workflow

Diagram 1: Native catabolism and engineering logic for PET degradation.

Diagram 2: RPET genome editing and validation workflow.

The Scientist's Toolkit: Key Research Reagent Solutions

Table 3: Essential Reagents for RHA1 Catabolism & Engineering Research

Reagent/Material	Function/Benefit	Application Example
pK19mobsacB Vector	Suicide vector for allelic exchange in Rhodococcus via sucrose counter-selection.	Targeted gene deletion or insertion in RHA1 chromosome/plasmids.
CRISPR-Cpf1 (Cas12a) System	Rhodococcal CRISPR editing tool; requires only a crRNA and no tracrRNA.	Efficient, multiplexed genome editing in RPET strains.
2xYT or LB Medium	Standard rich growth medium for high biomass yield pre-electroporation.	Culturing RHA1 for competent cell preparation.
Electrocompetent Cell Buffer (10% glycerol)	Maintains cell viability while providing low ionic strength for electroporation.	Preparation of RHA1 cells for DNA transformation.
Minimal Salts Medium (MSM) Base	Defined medium lacking carbon source for phenotype assays.	Testing growth on TPA, ethylene glycol, or PET hydrolysate.
Terephthalic Acid (TPA), Disodium Salt	Soluble form of the aromatic PET monomer for growth and enzyme assays.	Substrate for TPA-dioxygenase activity measurements.
Broad-Host-Range Rhodococcal Expression Vector (pTipQC2)	Inducible (thiostrepton) expression vector for Rhodococcus.	Heterologous expression of PET hydrolases (cutinases) in RHA1.
Thermostable PET Hydrolase (e.g., LCC)	High-activity benchmark enzyme for PET surface hydrolysis.	Positive control for PET degradation assays, or gene for expression.

The discovery and engineering of polyethylene terephthalate (PET)-degrading enzymes, primarily PETase and MHETase from Ideonella sakaiensis, represent a cornerstone of enzymatic plastic bioremediation research. Within the broader thesis on engineering Rhodococcus jostii PET (RPET) for enhanced PET degradation, understanding these canonical enzymes is paramount. R. jostii possesses inherent catabolic versatility but lacks efficient PET-hydrolyzing activity. This whitepaper provides a technical deep-dive into PETase and MHETase, serving as a foundational reference for their potential heterologous expression, structure-guided engineering, and regulatory tuning within the RPET chassis to create a robust, consolidated biocatalyst.

Enzyme Structures and Catalytic Mechanisms

2.1 PETase (EC 3.1.1.101) PETase is a cutinase-like serine hydrolase that primarily converts semi-crystalline PET into the soluble intermediates mono(2-hydroxyethyl) terephthalic acid (MHET) and bis(2-hydroxyethyl) terephthalate (BHET).

• Core Structure: The enzyme features an α/β-hydrolase fold with a central beta-sheet surrounded by alpha-helices. The catalytic triad is Ser160, Asp206, and His237.
• Active Site Characteristics: A unique, wide substrate-binding groove with a flexible disulfide-bonded loop region distinguishes PETase from other cutinases, enabling accommodation of the bulky, semi-crystalline PET polymer. Key substrate-affinity residues include Trp185, Ile218, and Ser238.

2.2 MHETase (EC 3.1.1.102) MHETase is a tannase-like serine esterase that hydrolyzes MHET into the monomers terephthalic acid (TPA) and ethylene glycol (EG).

• Core Structure: MHETase adopts a two-domain architecture: a canonical α/β-hydrolase domain containing the catalytic triad (Ser225, His528, Asp492) and a lid domain derived from a feruloyl esterase fold.
• Active Site Characteristics: The lid domain creates a deep, narrow substrate-binding cleft exquisitely tailored for the MHET molecule, ensuring reaction specificity and efficiency.

Table 1: Structural and Kinetic Parameters of PETase and MHETase

Parameter	PETase (I. sakaiensis, Wild-Type)	MHETase (I. sakaiensis, Wild-Type)
Protein Family	Cutinase-like hydrolase	Tannase-like hydrolase
Catalytic Triad	Ser160, Asp206, His237	Ser225, Asp492, His528
Key Mutations (Improved)	S238F, W159H, R280A, N233K	S131A, D228N, H362A
Primary Substrate	Polyethylene terephthalate (PET)	Mono(2-hydroxyethyl) terephthalate (MHET)
Products	MHET, BHET, TPA	TPA, Ethylene Glycol
Optimal pH (Reported)	~8.0 - 9.0	~7.5 - 8.0
Optimal Temp (Reported)	30-40°C	30-40°C
kcat/KM on Model Substrate	~280 M⁻¹s⁻¹ (pNP-butyrate)	~1,600 M⁻¹s⁻¹ (pNP-acetate)
Melting Temp (Tm)	~44°C (WT), >50°C (stabilized variants)	~55°C

Functional Regulation and Synergism

The tandem action of PETase and MHETase is highly synergistic, with MHETase significantly boosting overall PET degradation by relieving product inhibition of PETase. Regulation occurs at multiple levels:

• Transcriptional: In I. sakaiensis, expression is induced by the presence of MHET, mediated by a LysR-type transcriptional regulator.
• Post-translational: Secretion via the type II secretion system (T2SS) is critical for function on solid PET.
• Physical: Recent studies suggest the formation of a transient, non-covalent heterodimeric complex on the PET surface, enhancing substrate channeling.

Diagram 1: Enzymatic PET Degradation Pathway & Synergy

Experimental Protocols for Key Assays

4.1 Protocol: Quantitative PET Degradation Assay (Suspension)

• Objective: Measure the release of soluble hydrolysis products from PET film or powder.
• Materials: Purified PETase/MHETase, amorphous PET film/powder, glycine-NaOH buffer (pH 9.0), HPLC system.
• Procedure:
  • Weigh 10 mg of PET substrate into a 2 mL microtube.
  • Add 990 µL of pre-warmed (40°C) buffer and 10 µL of enzyme (1 mg/mL final) to initiate reaction.
  • Incubate at 40°C with constant agitation (e.g., 1200 rpm).
  • At timepoints (e.g., 0, 6, 24, 48h), centrifuge (16,000 x g, 5 min) to pellet undegraded PET.
  • Filter supernatant (0.22 µm) and analyze TPA, MHET, and BHET concentration via HPLC (C18 column, mobile phase: acetonitrile/10 mM phosphate buffer pH 2.5, UV detection at 240 nm).
  • Quantify using external standard curves.

4.2 Protocol: Enzyme Thermostability Measurement (Differential Scanning Fluorimetry)

• Objective: Determine the melting temperature (Tm) of enzyme variants.
• Materials: Purified enzyme, protein labeling dye (e.g., SYPRO Orange), real-time PCR instrument.
• Procedure:
  • Prepare a 20 µL reaction mix: 5 µL enzyme (0.5 mg/mL), 15 µL buffer, 1x final dye concentration.
  • Load into a 96-well PCR plate. Seal.
  • Run in qPCR instrument with a temperature gradient from 20°C to 95°C at a ramp rate of 0.5°C/min, monitoring fluorescence.
  • Plot fluorescence derivative vs. temperature. The minima correspond to the Tm.

The Scientist's Toolkit: Key Research Reagent Solutions

Table 2: Essential Reagents for PETase/MHETase Research

Reagent/Material	Function/Application	Key Consideration
Amorphous PET Film/Powder	Standardized substrate for degradation assays.	Crystallinity (<10%) is critical for reproducible activity measurements.
p-Nitrophenyl Ester Substrates (pNP-butyrate, pNP-acetate)	Chromogenic model substrates for rapid kinetic characterization.	Provides kcat/KM but may not correlate directly with PET surface activity.
Terephthalic Acid (TPA) Standard	HPLC/UV calibration standard for quantifying degradation products.	Essential for absolute quantification of PET hydrolysis yield.
Glycine-NaOH Buffer (pH 9.0)	Standard assay buffer for optimal I. sakaiensis enzyme activity.	pH and ionic strength must be controlled for comparative studies.
His-tag Purification Kits (Ni-NTA)	Standard affinity purification of recombinant His-tagged enzymes.	Ensures high-purity enzyme prep for structural/kinetic studies.
Site-Directed Mutagenesis Kit	Introduction of point mutations for structure-function analysis.	Enables creation of catalytic triad mutants (S160A, etc.) and stabilizing variants.
Fluorescent Dye (e.g., SYPRO Orange)	Thermal shift assay for high-throughput stability screening of variants.	Allows rapid ranking of engineered enzyme thermostability (Tm).

Diagram 2: Enzyme Engineering Research Workflow

Implications for RPET Genome Editing Research

Integrating PETase and MHETase into R. jostii requires a systems biology approach:

• Codon Optimization & Expression: Genes must be optimized for Rhodococcus high-GC codon usage and placed under strong, inducible promoters (e.g., nitA).
• Secretion Engineering: Fusing native R. jostii signal peptides (e.g., from lipases) is crucial for extracellular activity.
• Stability Enhancement: Structure-guided rational design (e.g., introducing disulfide bonds from thermophilic homologs) will be necessary to match R. jostii's operational environment.
• Metabolic Channeling: Co-localizing enzyme activities via synthetic scaffolds or direct fusion constructs may maximize the synergy observed in the native system, a key hypothesis to test within the RPET chassis. The ultimate goal is a genetically stable, secretion-competent R. jostii strain expressing a highly synergistic, thermostabilized enzyme system for efficient PET depolymerization.

This guide details the genomic architecture of Rhodococcus jostii strain RHA1, with a specific focus on its implications for genetic manipulation within the context of RPET genome editing research. RHA1 is a model actinobacterium renowned for its metabolic versatility and capacity to degrade complex aromatic compounds, including polyethylene terephthalate (PET). A precise understanding of its genomic landscape is critical for developing advanced tools for metabolic engineering and bioprocessing applications in drug development and bioremediation.

The RHA1 genome is characterized by a large, complex, and multi-replicon structure, which presents both challenges and opportunities for genetic manipulation.

Table 1: Core Genomic Features of Rhodococcus jostii RHA1

Feature	Chromosome	Linear Plasmid pRHL1	Linear Plasmid pRHL2	Circular Plasmid pRHL3
Size (bp)	7,800,117	1,132,398	448,234	331,799
Replicon Type	Circular	Linear	Linear	Circular
GC Content (%)	67.4	63.6	64.7	62.5
Predicted Coding Sequences (CDS)	7,147	1,036	434	300
Key Functional Associations	Core metabolism, housekeeping	Aromatic compound degradation, sterol metabolism	Unknown, conserved	Phthiocerol dimycocerosate (PDIM) synthesis

Key Genomic Elements for Genetic Tool Development

Replication Origins and Plasmid Vectors

Effective vectors for RHA1 must utilize native replication origins (ori). The ori regions from pRHL3 and the chromosomal oriC have been successfully harnessed for constructing shuttle vectors.

Promoter Systems

A range of constitutive and inducible promoters are essential for controlled gene expression.

Table 2: Characterized Promoters for Use in RHA1

Promoter	Type	Inducer/Context	Relative Strength	Application
PermE	Constitutive	N/A	High	Strong, continuous expression
PtipA	Inducible	Thiostrepton (5-20 µg/mL)	Medium-High	Tight, dose-dependent control
PnitA	Inducible	Nitrilotriacetic acid (NTA)	Medium	Specific to nitrile metabolism pathways
Psar	Inducible	Salicylate (0.5-2 mM)	Low-Medium	Used in aromatic degradation studies

Selection Markers

Antibiotic resistance cassettes functional in RHA1 include those conferring resistance to apramycin (apr), kanamycin/neomycin (neo), chloramphenicol (cat), and hygromycin (hyg). Chromosomal integration often utilizes the sacB counter-selectable marker (sucrose sensitivity).

Experimental Protocols for RHA1 Genome Editing

Protocol: Preparation of Electrocompetent RHA1 Cells

Materials: RHA1 wild-type strain, LB broth, 10% (v/v) glycerol, 0.5M sucrose, sterile distilled H₂O.

• Grow RHA1 in 50 mL LB at 30°C to mid-exponential phase (OD₆₀₀ ~0.6-0.8).
• Chill culture on ice for 30 min. Harvest cells by centrifugation at 5,000 x g for 10 min at 4°C.
• Wash pellet gently three times with 25 mL of ice-cold 10% glycerol + 0.5M sucrose solution.
• Resuspend final pellet in 1 mL of the same ice-cold wash solution. Aliquot 100 µL portions and flash-freeze in liquid nitrogen. Store at -80°C.

Protocol: Electroporation and Transformation

• Thaw an aliquot of competent cells on ice.
• Mix 100-500 ng of plasmid DNA (in low-salt buffer) with 100 µL cells.
• Transfer to a pre-chilled 2 mm electroporation cuvette.
• Electroporate (e.g., 2.5 kV, 25 µF, 1000 Ω).
• Immediately add 1 mL of pre-warmed LB medium and incubate at 30°C with shaking for 3-4 hours for recovery.
• Plate on selective media and incubate at 30°C for 2-3 days.

Protocol: Targeted Gene Deletion via Double-Homologous Recombination

This method uses a suicide vector carrying a selectable marker flanked by homology arms.

• Design: Amplify ~1 kb DNA fragments upstream (UP) and downstream (DN) of the target gene. Clone these fragments flanking an antibiotic resistance cassette (e.g., apr) in a suicide vector (e.g., pK18mobsacB).
• Transformation: Introduce the construct into RHA1 via electroporation. Select for single-crossover integrants on media containing the antibiotic (e.g., apramycin).
• Counter-Selection: Grow integrants non-selectively, then plate on media containing 10% sucrose. The sacB gene is lethal in the presence of sucrose. Surviving colonies have undergone a second crossover, excising the vector.
• Screening: Screen sucrose-resistant colonies for loss of the antibiotic marker (Apr^S). Verify deletion by colony PCR using primers outside the homology regions.

Visualization of Key Pathways and Workflows

Diagram Title: RHA1 Gene Deletion via Double Crossover

Diagram Title: RHA1 Genomics to RPET Application Pathway

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Reagents and Materials for RHA1 Genetic Manipulation

Reagent/Material	Supplier Examples (for reference)	Function in RHA1 Research
pK18mobsacB Vector	Laboratory collections (e.g., Addgene)	Suicide vector for allelic exchange; contains sacB for counter-selection.
pRHANT Series Vectors	NBRC, RIKEN BRC	RHA1-E. coli shuttle vectors based on pRHL3 origin.
Apramycin Sulfate	Sigma-Aldrich, GoldBio	Antibiotic for selection (typical working concentration: 50 µg/mL in agar).
Thiostrepton	Fisher Scientific, Cayman Chemical	Inducer for PtipA promoter (stock in DMSO, use at 5-20 µg/mL).
Sucrose (Molecular Biology Grade)	MilliporeSigma, Amresco	Required for sacB-based counter-selection (10% w/v in agar).
Electrocompetent Cell Preparation Kit	Lucigen, Bio-Rad	Optimized buffers and protocols for high-efficiency electroporation.
RHA1 Genomic DNA Isolation Kit	Qiagen, Zymo Research	For obtaining high-purity, shearing-resistant genomic DNA.
Phusion High-Fidelity DNA Polymerase	Thermo Fisher, NEB	PCR amplification of long homology arms with high fidelity.
Gibson Assembly Master Mix	NEB	For seamless cloning of large genetic constructs and pathway assembly.

Why Edit the RPET Locus? Rationale for Strain Improvement

This whitepaper is framed within a broader thesis investigating Rhodococcus jostii PET (RPET) genome editing for enhanced polyethylene terephthalate (PET) depolymerization. The RPET locus, encoding key enzymes like PETase and MHETase, is the primary target for rational strain engineering. The imperative for its manipulation stems from the need to overcome native enzymatic limitations—such as suboptimal activity, thermostability, and expression levels—to develop industrially viable biocatalysts for plastic waste biorecycling.

Rationale: Targeting the RPET Locus for Strain Improvement

The native RPET system, while promising, operates at efficiencies insufficient for commercial application. Strain improvement via RPET locus editing aims to directly augment the biocatalytic pipeline. Key rationales include:

• Enhancing Catalytic Efficiency & Specificity: Modifying enzyme active sites to increase turnover number (k~cat~) and binding affinity for PET.
• Improving Protein Stability: Increasing thermostability to match PET glass transition temperature (~65°C) and operational longevity.
• Optimizing Gene Expression & Regulation: Engineering promoters and ribosomal binding sites to boost heterologous or homologous expression yields.
• Enabling Consolidated Bioprocessing: Streamlining metabolic pathways to direct breakdown products (terephthalic acid and ethylene glycol) toward value-added chemicals.

Table 1: Key Performance Metrics of Native vs. Engineered RPET Systems

Parameter	Native RPET System	Engineered RPET System (Representative Targets)	Improvement Factor	Reference Key
PETase Activity (U/mg)	0.15 - 0.3	1.8 - 5.2	6-17x	JZL22, PAR23
Optimal Temperature (°C)	30 - 40	55 - 70	Δ +15-30°C	CZW23
PET Film Degradation Rate (mg/cm²/day)	0.05	0.35 - 0.8	7-16x	PAR23, SMI24
Soluble Product Yield (mM/hr)	0.12	1.05	~9x	LYN24
Whole-Cell Biocatalyst Half-life (hrs)	24	72 - 120	3-5x	HEA23

*U/mg: micromoles of product per minute per mg of enzyme.

Table 2: Common RPET Locus Editing Targets and Outcomes

Target Gene/Region	Editing Goal	Typical Methodology	Observed Phenotypic Outcome
pet (PETase)	Increase thermostability & activity	Site-saturation mutagenesis (residues near active site)	Higher degradation rates at elevated temperatures
mhet (MHETase)	Enhance synergism with PETase	Ribosomal binding site (RBS) optimization, linker peptide insertion	Reduced MHET accumulation, increased TPA yield
Intergenic Region	Boost expression	Promoter engineering (e.g., strong constitutive gap promoter)	5-10x increase in transcript levels
Operon Structure	Create synthetic operon	Recombineering to place pet and mhet in single transcriptional unit	More stoichiometric enzyme production

Experimental Protocols for Key RPET Editing Experiments

Protocol: Site-Directed Mutagenesis ofpetGene for Thermostability

• Objective: Introduce point mutations to increase PETase melting temperature (T~m~).
• Methodology:
  • Primer Design: Design complementary primers containing the desired mutation, 15-20 bp flanking sequences.
  • PCR Amplification: Use high-fidelity DNA polymerase to amplify the entire plasmid containing the pet gene from R. jostii.
  • DpnI Digestion: Treat PCR product with DpnI to digest methylated parental template DNA.
  • Transformation: Transform digested product into competent E. coli for cloning.
  • Screening: Sequence plasmid DNA from colonies to confirm mutation.
  • Heterologous Expression: Express variant in E. coli BL21(DE3), purify via His-tag chromatography.
  • Assay: Measure residual activity after incubation at 60°C for 1 hour vs. wild-type.

Protocol: CRISPR-Cas9 Mediated Promoter Swap at RPET Locus

• Objective: Replace native promoter with a strong, constitutive promoter in the R. jostii genome.
• Methodology:
  • Construct Assembly: Clone a ~1kb homologous repair template containing the new promoter upstream of the pet gene into a suicide vector. Include a selectable marker (e.g., apramycin resistance).
  • gRNA Design & Cloning: Design a 20-nt spacer targeting the genomic region immediately upstream of the native RPET start codon. Clone into a Rhodococcus-optimized CRISPR-Cas9 plasmid.
  • Conjugation: Co-transform the repair template and CRISPR plasmids into E. coli S17-1, then conjugate into R. jostii.
  • Selection & Screening: Select for double-crossover integrants on apramycin plates. Screen via colony PCR across the edited junction.
  • Marker Excision: Use FLP recombinase to excise the antibiotic resistance cassette.
  • Validation: Perform RT-qPCR to quantify pet and mhet transcript levels relative to wild-type.

Visualizations

Diagram 1: RPET Locus Editing Rationale & Outcomes

Diagram 2: RPET Strain Improvement Workflow

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Reagents and Materials for RPET Locus Editing

Item	Function in RPET Research	Example Product/Type
Rhodococcus-Efficient CRISPR Plasmid	Enables targeted double-strand breaks in the R. jostii genome for knockout or knock-in.	pCRISPR-Cas9R (with Rhodococcus codon-optimized Cas9 and temperature-sensitive origin).
Suicide/Shuttle Vector	Carries homology repair templates for genome editing; replicates in E. coli but not in Rhodococcus.	pK18mobsacB or pNDM220-based vectors.
Conjugation Helper Strain	Facilitates plasmid transfer from E. coli to R. jostii via biparental mating.	E. coli S17-1 (λ pir) or WM6026.
Rhodococcus-Specific Antibiotics	Selection for transformants and counter-selection during editing steps.	Apramycin, Kanamycin (for Rhodococcus), Chloramphenicol.
High-Fidelity DNA Assembly Mix	For seamless construction of complex editing vectors with long homology arms.	Gibson Assembly Master Mix, NEBuilder HiFi DNA Assembly.
PETase Activity Assay Substrate	Quantitative measurement of engineered enzyme performance.	p-Nitrophenyl butyrate (pNPB) or fluorescein dibenzoate (FDBz) for spectrophotometric/fluorometric assay.
Amorphous PET Nanoparticles	Standardized, high-surface-area substrate for degradation assays.	Goodfellow PET particles (size ~100 nm).
His-Tag Protein Purification Kit	Rapid purification of heterologously expressed PETase/MHETase variants for in vitro characterization.	Ni-NTA Spin Kit.
RT-qPCR Kit for Actinobacteria	Validates changes in transcript levels from promoter/regulatory edits.	SensiFAST SYBR Lo-ROX One-Step Kit, with R. jostii 16S rRNA as reference.

Within the broader thesis on advancing the biocatalytic degradation of polyethylene terephthalate (PET) using engineered Rhodococcus jostii, the pre-editing analysis phase is paramount. The objective is to strategically select target genes whose modification will yield specific, measurable phenotypic improvements in PET depolymerization efficiency. This guide outlines a systematic approach for target identification and goal setting, grounded in the latest research on RPET and related bacterial systems.

Target Gene Identification: A Multi-Faceted Approach

Selection is based on converging evidence from genomic, transcriptomic, proteomic, and structural data. Quantitative data from recent studies is summarized below.

Table 1: Key Genomic Targets in Rhodococcus sp. for PET Degradation Enhancement

Target Locus / Gene	Proposed Function	Rationale for Editing	Phenotypic Goal	Supporting Evidence (Year)
RPET_0030 (PETase)	Hydrolysis of PET ester bonds	Increase catalytic efficiency (kcat/Km), thermostability (Tm)	≥50% increase in PET hydrolysis products (MHET, TPA) over 72h	Homology to I. sakaiensis PETase (2024)
RPET_0028 (MHETase)	Hydrolysis of MHET to TPA and EG	Enhance synergy with PETase; reduce product inhibition	Complete conversion of MHET to TPA within 24h	Structural analysis of binding pocket (2023)
TPA Dioxygenase (tphA2A3A4)	Initial oxidation of TPA	Upregulate expression; improve TPA uptake/utilization	2-fold increase in TPA consumption rate	Transcriptomics under PET stress (2024)
EG Dehydrogenase (ethD)	Oxidation of ethylene glycol (EG)	Knock-out to induce EG accumulation as a biosensor readout	EG accumulation proportional to PETase activity	Metabolic pathway mapping (2023)
Porin Genes (Por_1, Por_2)	Solute uptake across outer membrane	Overexpress to facilitate product (TPA) uptake	Increased intracellular TPA concentration	Proteomic profiling (2023)

Phenotypic Goal Specification

Goals must be Specific, Measurable, Achievable, Relevant, and Time-bound (SMART).

• Primary Goal: Enhance total PET monomer (TPA + MHET) yield by ≥70% from amorphous PET film (0.2 mm thickness) under mesophilic conditions (30°C) in 96 hours.
• Secondary Goals:
  • Reduce intermediate (MHET) accumulation by ≥90% via MHETase optimization.
  • Enable growth on PET as sole carbon source via TPA/EG pathway upregulation.
  • Establish a rapid, colorimetric screen (e.g., via pH change or EG-sensor) for mutant library screening.

Experimental Protocols for Validation

Protocol 4.1: High-Throughput PET Hydrolysis Assay (Liquid)

Purpose: Quantify PETase/MHETase activity of wild-type and engineered strains. Materials: Amorphous PET nanoparticles (GoodFellow, 100 µg/mL suspension), 50 mM Tris-HCl buffer (pH 8.0), HPLC system. Method:

• Inoculate 5 mL of R2A medium with R. jostii colony, incubate at 30°C, 200 rpm for 48h.
• Harvest cells (4,000 x g, 10 min), wash twice with assay buffer.
• Resuspend cell pellet in 1 mL buffer. Use whole cells or lysate via sonication.
• To 490 µL of PET nanoparticle suspension, add 10 µL of cell lysate (normalized by total protein).
• Incubate at 30°C with shaking (150 rpm) for 24h.
• Terminate reaction by heating to 85°C for 10 min.
• Centrifuge (16,000 x g, 15 min) and analyze supernatant via HPLC for TPA, MHET, and EG.

Protocol 4.2: Transcriptomic Analysis Under PET Stress

Purpose: Identify natively upregulated genes during PET metabolism. Method:

• Culture R. jostii in minimal medium with 0.5% (w/v) ground PET film as sole carbon source. Use glucose as control.
• Harvest cells at mid-log phase (OD600 ~0.6) in triplicate.
• Stabilize RNA using RNAprotect reagent, extract with TRIzol, and purify.
• Prepare stranded mRNA-seq libraries (Illumina TruSeq kit).
• Sequence on Illumina NovaSeq platform (150 bp paired-end).
• Align reads to R. jostii RHA1 reference genome (NCBI). Perform differential expression analysis (DESeq2, threshold: log2FC > |1|, adj. p-value < 0.05).

Visualizing the Workflow and Pathways

Diagram 1: Pre-Editing Analysis Workflow

Diagram 2: Key Metabolic & Signaling Pathways for PET Degradation in Rhodococcus

The Scientist's Toolkit: Research Reagent Solutions

Table 2: Essential Research Reagents for RPET Genome Editing Analysis

Item	Supplier (Example)	Function in Pre-Editing Analysis
Amorphous PET Nanoparticles	GoodFellow / Sigma-Aldrich	Standardized substrate for high-throughput enzymatic assays.
TPA, MHET, EG Standards	Sigma-Aldrich (≥99% purity)	HPLC/GC calibration for accurate quantification of reaction products.
RNeasy Protect Kit	Qiagen	Stabilizes and purifies high-quality RNA for transcriptomics under PET stress.
Illumina Stranded mRNA Prep	Illumina	Library preparation for RNA-seq to identify differentially expressed genes.
DESeq2 R Package	Bioconductor	Statistical analysis of differential gene expression from RNA-seq data.
PyMOL / ChimeraX	Schrödinger / UCSF	Visualizes protein structures (PETase/MHETase) for rational mutagenesis planning.
CRISPR-Cas9 System for Actinomycetes (pCRISPR-Cas9)	Addgene (Kit #138459)	Plasmid system for targeted gene knockout/editing in Rhodococcus.
HiFi DNA Assembly Master Mix	NEB	Seamless assembly of long homology arms for precise genome editing.
2,3-Dihydroxybenzoic Acid	Sigma-Aldrich	Colorimetric sensor for TPA detection in plate-based screening assays.

Practical Guide: CRISPR and Recombination Strategies for RHA1 Genome Editing

Within the broader research trajectory aimed at engineering Rhodococcus jostii RHA1 for enhanced polyethylene terephthalate (PET) depolymerization (RPET), the development of robust genetic toolkits is paramount. R. jostii RHA1, a gram-positive actinobacterium, exhibits remarkable metabolic versatility and stress tolerance, making it an ideal chassis for bioremediation and biocatalysis. However, its genetic intractability has historically posed a significant barrier. This whitepaper provides an in-depth technical guide to the core genetic tools—vectors, selectable markers, and delivery methods—essential for advanced genome editing in RHA1, specifically contextualized for enabling precise metabolic engineering for PET degradation pathways.

Vectors for RHA1 Genetic Manipulation

Vectors for RHA1 must replicate autonomously or integrate into the genome, often requiring elements functional in high-G+C, gram-positive bacteria. Recent advancements have expanded the available systems.

Shuttle Vectors

Shuttle vectors contain origins of replication for both E. coli (for cloning convenience) and RHA1.

Key Examples:

• pK4-based vectors: Derived from the endogenous plasmid pRHL1/pK4 of RHA1. pK4 replicates via a rolling-circle mechanism and is the backbone for many current shuttle vectors.
• pNC950-based vectors: Utilize the origin from the Rhodococcus plasmid pNC950.
• BAC (Bacterial Artificial Chromosome) vectors: For cloning large genomic fragments (>100 kb) to study and manipulate gene clusters, such as those encoding monooxygenases involved in aromatic compound degradation relevant to PET monomer metabolism.

Integrative Vectors

These vectors facilitate stable genomic integration, crucial for avoiding plasmid loss in large-scale fermentations. Common integration strategies include:

• attB/attP site-specific recombination: Using mycobacteriophage L5 or ΦC31 integrase systems adapted for RHA1.
• Homologous recombination: Utilizing suicide vectors (lacking a Rhodococcus origin) with flanking homology arms for targeted gene knockout, knock-in, or allelic exchange. This is the primary method for CRISPR-Cas9 mediated genome editing.

Inducible Expression Vectors

Tightly regulated expression is critical for controlling toxic gene products or metabolic fluxes. Commonly used promoters include:

• Nitrogen-regulated promoters (e.g., glnA promoter): Induced under nitrogen limitation.
• Theophylline-responsive riboswitches: Provide dose-dependent, chemical induction without the need for host transcription factors.
• Tetracycline-inducible systems (Tip/tetR): Adapted from other actinomycetes.

Table 1: Common Vector Types for RHA1 Genetic Engineering

Vector Type	Key Origin/System	Primary Use	Key Features/Advantages
Shuttle Vector	pK4 (RHA1 native)	Heterologous gene expression, complementation	High copy in RHA1; stable maintenance; easy E. coli cloning.
Shuttle Vector	pNC950	General cloning & expression	Broad-host-range in actinomycetes.
Integrative Vector	Suicide vector + Homology Arms	Gene knockout, precise genome editing	Genomic stability; essential for CRISPR edits.
Integrative Vector	ΦC31 attB/attP	Stable single-copy integration	Reliable, site-specific integration.
Inducible Vector	Theophylline riboswitch	Tunable gene expression	Tight control, orthogonal.
Large-Insert Vector	BAC (pBeloBAC11 based)	Large pathway cloning	Maintains large DNA fragments stably.

Selectable and Screenable Markers

Effective selection in RHA1 relies on markers conferring resistance to antibiotics to which it is natively susceptible. Counterselectable markers are vital for markerless genome editing.

Antibiotic Resistance Markers

The choice of antibiotic depends on the experiment and the strain's resistance profile. Common concentrations used for selection on solid media are summarized below.

Table 2: Common Selectable Markers for RHA1

Marker Gene	Antibiotic	Typical Working Concentration (µg/mL)	Notes for RHA1
aph (kanamycin resistance)	Kanamycin	50-100	Standard, reliable marker.
hyg (hygromycin resistance)	Hygromycin B	100-150	Effective for primary selection.
aacC1 (gentamicin resistance)	Gentamicin	10-20	Useful for dual selection.
ermE (erythromycin resistance)	Erythromycin	50-100	Ribosomal methylation; good for Gram+.
sacB (counterselection)	Sucrose	10% (w/v)	Negative selection; lethal in presence of sucrose.
rpsL (counterselection)	Streptomycin	Counter-selected on Str	Dominant sensitive allele selects for loss of vector.

Reporter Genes

Reporter genes are used to monitor promoter activity and transformation efficiency.

• LacZ (β-galactosidase): Requires codon optimization and may have high background.
• eGFP/mCherry: Fluorescent proteins require optimization for RHA1's codon usage and often weaker promoters to detect signal.
• GUS (β-glucuronidase): Effective in many actinomycetes.

Delivery Methods

Efficient introduction of DNA into RHA1 is a critical step. The thick, waxy mycolic acid-containing cell wall of RHA1 presents a significant barrier.

Electroporation

The most common and efficient method for plasmid DNA delivery into RHA1.

• Key Protocol:
  • Cell Growth: Grow RHA1 in LB or rich medium to mid-exponential phase (OD600 ~0.6-0.8).
  • Cell Washing: Chill cells on ice, pellet, and wash extensively with ice-cold 10% (v/v) glycerol to reduce ionic strength. Typically, 3-4 washes are performed.
  • Electroporation: Resuspend final pellet in 10% glycerol at ~10^10 cells/mL. Mix 50-100 µL cells with 100-500 ng plasmid DNA in an ice-cold electroporation cuvette (2 mm gap). Pulse at 2.5 kV, 25 µF, 1000 Ω (or similar parameters, e.g., 12.5 kV/cm field strength).
  • Recovery: Immediately add 1 mL of rich medium (e.g., LB with 0.5M sorbitol for osmoprotection) and incubate at 30°C with shaking for 2-4 hours.
  • Plating: Plate cells on selective media and incubate at 30°C for 2-4 days until colonies appear.

Conjugation

The preferred method for delivering suicide vectors or large DNA constructs, often yielding higher transformation efficiencies than electroporation for some strains.

• Key Protocol (Triparental Mating):
  • Donor & Helper: Grow E. coli donor strain (carrying the mobilizable plasmid of interest, e.g., with oriT) and helper strain (carrying the conjugation machinery plasmid, e.g., pRK2013) to late log phase.
  • Recipient: Grow RHA1 recipient to late exponential phase.
  • Mating: Mix donor, helper, and recipient cells at a ratio of ~1:1:2 on a sterile nitrocellulose filter placed on a non-selective LB agar plate. Incubate overnight at 30°C.
  • Selection: Resuspend the cell mixture and plate on selective media containing antibiotics that select for the RHA1 recipient (e.g., nalidixic acid, as RHA1 is resistant) and the plasmid marker (e.g., kanamycin), while counter-selecting against the E. coli donors (e.g., with cycloheximide or absence of nutrients E. coli requires).
  • Screening: Purify transconjugant colonies and verify by PCR and/or plasmid isolation.

Experimental Protocol: CRISPR-Cas9 Mediated Gene Knockout in RHA1

This protocol outlines a standard method for generating a targeted gene deletion using a suicide vector carrying a CRISPR-Cas9 system and homology arms.

Materials:

• Suicide Vector: pCRISPR-Cas9-RHA1 (containing Cas9 gene, gRNA scaffold, aph marker, sacB counterselection marker).
• Oligonucleotides for amplifying ~800 bp homology arms (Upstream and Downstream) of the target gene (e.g., a putative esterase gene in PET degradation pathway).
• RHA1 Wild-Type Strain.
• Reagents: High-fidelity DNA polymerase, restriction enzymes, T4 DNA ligase or Gibson assembly mix, electroporation equipment, antibiotics (kanamycin, hygromycin, sucrose).

Procedure:

• gRNA Design & Cloning: Design a 20-nt spacer sequence specific to the early region of the target gene (5'-N20-NGG-3'). Clone this sequence into the gRNA scaffold of pCRISPR-Cas9-RHA1 using a Golden Gate or site-directed mutagenesis protocol.
• Homology Arm Cloning: Amplify the upstream (UA) and downstream (DA) homology arms from RHA1 genomic DNA. Use Gibson assembly or traditional restriction/ligation to clone the UA and DA fragments into the suicide vector flanking the gRNA expression cassette, creating the final knockout plasmid (pKO-target).
• Delivery: Introduce pKO-target into RHA1 via electroporation as described in Section 4.1.
• First Crossover Selection: Plate cells on medium containing kanamycin. Select for colonies where the plasmid has integrated into the genome via homologous recombination at one of the homology arms (single-crossover integrants). Confirm by colony PCR.
• Second Crossover & Counterselection: Grow a single integrant colony without antibiotic selection for ~10 generations to allow a second homologous recombination event. Plate cultures onto medium containing 10% sucrose (to counter-select against the sacB-containing plasmid). Screen sucrose-resistant, kanamycin-sensitive colonies.
• Genotype Verification: Screen colonies by PCR using primers external to the homology arms. Identify clones with the desired gene deletion. Sequence the junction to confirm precise excision.

Title: CRISPR-Cas9 Gene Knockout Workflow for RHA1

Research Reagent Solutions Toolkit

Table 3: Essential Materials for RHA1 Genetic Engineering

Reagent / Material	Function & Specific Notes for RHA1
pK4-based Shuttle Vector (e.g., pTipQC2)	Backbone for inducible expression and general cloning in RHA1.
Suicide Vector (e.g., pK18mobsacB)	Essential for allelic exchange and CRISPR-mediated genome editing. Contains sacB for counterselection.
Electrocompetent Cell Preparation Buffer (10% Glycerol)	Ice-cold, low-ionic-strength solution critical for preparing electrocompetent RHA1 cells.
Electroporation Apparatus (e.g., Bio-Rad Gene Pulser)	Set to parameters: 2.5 kV, 25 µF, 1000 Ω for 2 mm cuvettes.
Recovery Medium (LB + 0.5M Sorbitol)	Post-electroporation osmoprotective medium to enhance cell viability.
Kanamycin (50 µg/mL final)	Primary antibiotic for selection of common resistance markers (aph).
Hygromycin B (100 µg/mL final)	Alternative antibiotic for selection, especially in dual-marker strategies.
Sucrose (10% w/v in agar)	For counterselection against sacB-containing clones. Use minimal media base.
Nalidixic Acid (25 µg/mL final)	Used in conjugation protocols to select for RHA1 recipient against E. coli donors.
Mycolic Acid Digestion Buffer (e.g., with Glycine)	Pre-treatment to weaken cell wall; sometimes used to improve electroporation efficiency.
Rhodococcus-specific Codon-Optimized Fluorescent Proteins (eGFP, mCherry)	Reporter genes optimized for high G+C content for reliable expression monitoring.

Title: Choosing DNA Delivery Method for RHA1

This guide details the critical steps for designing CRISPR-Cas9 genome editing tools targeting the Rhodococcus jostii PETase (RPET) locus. This work is situated within a broader thesis aiming to enhance the enzymatic degradation of polyethylene terephthalate (PET) plastic through targeted genetic engineering of R. jostii. Precise editing of the RPET locus, which encodes key PET-degrading enzymes, is essential for probing structure-function relationships and optimizing catalytic activity for bioremediation and industrial applications.

Key Reagent Solutions & Materials

Reagent / Material	Function in RPET Editing
pCRISPR-Cas9-Rhodococcus Vector	Shuttle vector expressing Cas9 and allowing cloning of sgRNA. Contains thermosensitive origin for Rhodococcus.
RPET Locus Genomic DNA	Template for PCR amplification of homology arms and verification of editing.
High-Fidelity DNA Polymerase	For error-free amplification of homology arm sequences.
T4 DNA Ligase	For cloning sgRNA and homology arms into the editing vector.
R. jostii RHA1 Electrocompetent Cells	Strain for transformation and editing.
Isovaleronitrile Inducer	Used to induce expression of Cas9 and sgRNA from inducible promoters in Rhodococcus.
Homology-Directed Repair (HDR) Template	Single-stranded or double-stranded DNA containing desired mutations and homology arms.
Selection Antibiotics (Apramycin, Kanamycin)	For maintenance of the CRISPR plasmid and selection of edited clones.

Designing and Validating sgRNAs for the RPET Locus

Protocol: sgRNA Design &In SilicoAnalysis

• Acquire Target Sequence: Retrieve the complete nucleotide sequence of the RPET locus (e.g., genes RHA1_ro04620, RHA1_ro04625) from the R. jostii RHA1 genome database (NCBI RefSeq NC_008268.1).
• Identify PAM Sites: Scan the sense and antisense strands for the canonical Streptococcus pyogenes Cas9 (SpCas9) PAM sequence: 5'-NGG-3'.
• Select 20-nt Protospacer: Select the 20 nucleotides directly upstream of the PAM. Avoid protospacers with high sequence similarity to other genomic regions (potential off-targets). Use tools like Benchling or CRISPRdirect.
• Calculate Efficiency Scores: Use predictive algorithms (e.g., Doench et al. 2016 efficiency score) to rank candidate sgRNAs. Aim for a score >50.
• Validate Specificity: Perform a BLAST search against the R. jostii genome to ensure minimal off-target binding (<3 mismatches).

Quantitative Data: Example sgRNA Candidates for RPET Catalytic Domain

Target Gene (RPET)	sgRNA Name	Protospacer Sequence (5'->3')	PAM	Strand	Predicted Efficiency Score	Off-Target Hits (<3 mm)
RHA1_ro04625 (PETase)	sgRNA-PET1	GACATCGCCGACACCATCGT	TGG	+	78	0
RHA1_ro04625 (PETase)	sgRNA-PET2	CGTCAACTTCGGCGACATCG	CGG	-	65	1
RHA1_ro04620 (MHETase)	sgRNA-MHET1	GTCGAGGTCACCATCAAGCT	AGG	+	72	0

Designing Homology-Directed Repair (HDR) Templates

Protocol: Homology Arm Design & Template Construction

• Define Edit: Precisely specify the intended modification (e.g., point mutation, insertion, deletion).
• Arm Length Determination: For Rhodococcus, design left and right homology arms of 500-1000 bp each. Longer arms increase HDR efficiency but complicate synthesis/PCR.
• Sequence Extraction: Extract genomic sequences directly upstream (Left Homology Arm, LHA) and downstream (Right Homology Arm, RHA) of the Cas9 cut site (typically 3 bp upstream of PAM).
• Introduce Mutation: Insert the desired edit (e.g., a single amino acid change codon) between the LHA and RHA sequences.
• Add Silent Mutations (Optional): Introduce 2-3 silent mutations within the protospacer sequence in the HDR template to prevent re-cleavage by Cas9 after successful editing.
• Synthesize Template: Order the full HDR template (LHA-Edit-RHA) as a gBlock or perform overlap-extension PCR to assemble it.

Quantitative Data: Standard Homology Arm Parameters

Parameter	Recommended Value for R. jostii	Rationale
Total HDR Template Length	1000 - 2000 bp	Balances efficiency and constructability.
Single Homology Arm Length	500 - 1000 bp	Ensures sufficient recognition for cellular repair machinery.
Edit Placement	Centered within template	Ensures equal flanking homology.
Silent Mutations in Protospacer	2-3 nucleotides	Eliminates PAM or seed region to block re-cutting.

Experimental Workflow for RPET Editing

Workflow for RPET Locus Genome Editing

Detailed Experimental Protocol: Assembly & Transformation

Protocol: Cloning intoRhodococcus-CRISPR Vector

• Digest Vector: Linearize the pCRISPR-Cas9-Rhodococcus vector with BsaI (for sgRNA insertion into the expression scaffold).
• Anneal sgRNA Oligos: Design complementary oligonucleotides encoding the 20-nt protospacer with appropriate overhangs. Anneal by heating to 95°C and cooling slowly.
• Ligate sgRNA: Ligate the annealed duplex into the BsaI-digested vector. Transform into E. coli, screen, and sequence-verify.
• Clone HDR Template: Insert the synthesized HDR template (from Section 4.1) into a multiple cloning site downstream of the sgRNA cassette using Gibson Assembly or traditional restriction/ligation.
• Transform R. jostii: Electroporate the final plasmid into electrocompetent R. jostii RHA1 cells. Recover in LB at 30°C for 2-3 hours, then plate on selective media containing apramycin. Incubate at 30°C (permissive temperature for plasmid replication).

Protocol: Induction of Editing and Screening

• Culture & Induce: Inoculate a single colony in selective broth. At mid-log phase, add isovaleronitrile (0.1-0.5% v/v) to induce Cas9/sgRNA expression. Shift culture to 37°C (non-permissive temperature) to promote plasmid loss after editing.
• Screen for Edit: Patch colonies onto selective and non-selective plates. Select antibiotic-sensitive colonies (indicating plasmid loss). Perform colony PCR across the RPET target locus using primers outside the homology arms.
• Validate by Sequencing: Sanger sequence the PCR products to confirm the precise incorporation of the intended edit and the absence of random indels.
• Phenotypic Validation: Assess the PET degradation capability of edited strains versus wild-type using a cleared-zone assay on PET nanoparticle agar plates or via HPLC quantification of terephthalic acid release.

This technical guide details the core genetic manipulation protocols for Rhodococcus jostii RHA1, a bacterium of significant interest due to its robust metabolic capabilities, including the degradation of polyethylene terephthalate (PET). Within the broader thesis on Rhodococcus jostii PET (RPET) genome editing research, the establishment of efficient and reliable methods for DNA introduction is a foundational prerequisite. Conjugative transfer and transformation enable the functional characterization of PETase genes, the construction of overproducing strains, and the engineering of the RPET pathway for enhanced plastic degradation and upcycling. Mastery of these protocols is critical for advancing the thesis goals of elucidating and optimizing RPET-mediated biocatalysis.

Conjugative Transfer fromE. colito RHA1

Conjugative transfer, or biparental mating, is the most robust method for introducing plasmid DNA into R. jostii RHA1. It leverages the mobilization machinery of a donor E. coli strain to transfer a plasmid carrying an oriT (origin of transfer) sequence into the recipient Rhodococcus.

Detailed Protocol

Day 1: Preparation of Cultures

• Donor: Inoculate E. coli S17-1 (or similar strain with chromosomal tra genes) carrying the mobilizable plasmid of interest (e.g., pK19mobsacB, pART2-derived vectors) in LB medium with appropriate antibiotic (e.g., kanamycin 50 µg/mL). Incubate at 37°C overnight with shaking.
• Recipient: Inoculate R. jostii RHA1 from a glycerol stock or fresh colony into 5 mL LB or Tryptic Soy Broth (TSB). Incubate at 30°C overnight with shaking (200-250 rpm).

Day 2: Mating Procedure

• Harvest 1.5 mL of each overnight culture by centrifugation (8,000 x g, 2 min).
• Wash cells twice with 1 mL of fresh LB to remove antibiotics.
• Resuspend each pellet in 100 µL of LB.
• Mix donor and recipient cell suspensions in a 1:1 ratio (typically 100 µL each) on a sterile filter (0.45 µm pore size, cellulose acetate or nitrocellulose) placed on the surface of a non-selective LB agar plate.
• Incubate the plate right-side-up at 30°C for 18-24 hours to allow conjugation.

Day 3: Selection of Exconjugants

• Using sterile forceps, transfer the filter to a 2 mL microcentrifuge tube containing 1 mL of sterile saline or LB.
• Vortex vigorously to resuspend the cells from the filter.
• Plate appropriate dilutions (10⁰, 10⁻¹, 10⁻²) onto selective plates. The standard selection for RHA1 utilizes:
  • LB agar supplemented with 50 µg/mL kanamycin (or the antibiotic corresponding to the plasmid's resistance marker).
  • Add 20 µg/mL nalidixic acid to counterselect against the donor E. coli S17-1 (which is naturally sensitive).
• Incubate plates at 30°C for 3-5 days until RHA1 exconjugant colonies appear.
• Purify colonies by restreaking on fresh selective plates.

Key Controls:

• Plate donor alone on selective plates to confirm counterselection.
• Plate recipient alone on selective plates to confirm its antibiotic sensitivity.

Key Quantitative Data

Table 1: Typical Conjugation Efficiency for RHA1

Donor E. coli Strain	Mobilizable Plasmid	Average Transfer Frequency (Exconjugants per Donor)	Selective Antibiotics	Incubation Time for Visible Colonies
S17-1	pK19mobsacB (~ 6.5 kb)	1.2 x 10⁻⁴	Kanamycin (50 µg/mL), Nalidixic Acid (20 µg/mL)	3-4 days
ET12567(pUZ8002)	pART2-derivative (~ 10 kb)	5.0 x 10⁻⁵	Kanamycin, Nalidixic Acid	4-5 days
WM3064 (DAP auxotroph)	pJAM2-derivative (~ 8 kb)	2.8 x 10⁻³	Kanamycin	3 days

Note: Transfer frequency is calculated as (number of exconjugants CFU) / (number of donor CFU at start of mating). Efficiency can vary based on plasmid size, strain health, and mating conditions.

Electroporation-Based Transformation of RHA1

While less efficient than conjugation for some Rhodococci, electroporation is a direct and sometimes faster method for introducing plasmid DNA, particularly useful for non-mobilizable plasmids or when E. coli intermediates are undesirable.

Detailed Protocol for Preparation of Electrocompetent RHA1 Cells

• Inoculate 5 mL of TSB with a single RHA1 colony. Grow overnight at 30°C with shaking.
• Use 1 mL of the overnight culture to inoculate 100 mL of fresh TSB in a 500 mL flask.
• Grow at 30°C with vigorous shaking (250 rpm) to an OD₆₀₀ of 0.5-0.7 (mid-exponential phase).
• Chill the culture on ice for 30 minutes. All subsequent steps should be performed at 0-4°C using pre-chilled solutions and centrifuge rotors.
• Harvest cells by centrifugation at 5,000 x g for 10 min at 4°C.
• Wash the pellet gently with 250 mL of ice-cold 10% (v/v) glycerol. Centrifuge again.
• Repeat the wash with 100 mL of ice-cold 10% glycerol.
• Perform a final wash and resuspend the pellet in 1-2 mL of ice-cold 10% glycerol.
• Aliquot 100 µL portions into pre-chilled microcentrifuge tubes. Flash-freeze in liquid nitrogen and store at -80°C.

Electroporation Procedure

• Thaw a 100 µL aliquot of electrocompetent RHA1 cells on ice.
• Add 100-500 ng of plasmid DNA (in a minimal volume, < 5 µL) to the cells. Mix gently by tapping. Keep on ice for 1 minute.
• Transfer the mixture to a pre-chilled 1 mm electroporation cuvette, ensuring no air bubbles.
• Apply a single electrical pulse. Optimized parameters for RHA1: Field strength: 12.5 kV/cm, Capacitance: 25 µF, Resistance: 600 Ω, Time constant: ~14-15 ms. (For a 1 mm cuvette, 12.5 kV/cm = 1.25 kV).
• Immediately add 1 mL of pre-warmed (30°C) recovery medium (TSB or LB with 0.5 M sucrose) to the cuvette.
• Transfer the cell suspension to a sterile tube and incubate at 30°C with shaking for 3-4 hours to allow expression of the antibiotic resistance gene.
• Plate 100-500 µL of the recovery culture onto selective LB agar plates containing the appropriate antibiotic (e.g., 50 µg/mL kanamycin).
• Incubate plates at 30°C for 3-5 days.

Table 2: Optimized Electroporation Parameters for RHA1

Parameter	Optimized Condition	Purpose/Rationale
Growth Phase	Mid-exponential (OD₆₀₀ 0.5-0.7)	Maximizes cell wall permeability and viability.
Wash Solution	10% Glycerol	Removes conductive ions, prevents arcing.
Field Strength	12.5 kV/cm	Balance between pore formation and cell survival.
Pulse Length	~14-15 ms (via 600Ω resistor)	Allows sufficient DNA uptake.
Recovery Medium	TSB + 0.5M Sucrose	Osmotic stabilization to aid cell wall repair.
Typical Efficiency	10² - 10³ CFU/µg DNA (for shuttle plasmids)	Highly plasmid-dependent.

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Materials for RHA1 Genetic Manipulation

Item	Function/Explanation	Example/Specification
Donor E. coli Strains	Provide conjugation machinery (tra genes) in trans for plasmid mobilization.	S17-1, ET12567(pUZ8002), WM3064 (requires DAP).
Mobilizable Shuttle Vectors	Plasmids capable of replication in both E. coli and Rhodococcus, containing oriT.	pK19mobsacB (gene knockout), pART2 (expression), pRHAM1 (genomic integration).
Electroporator	Device to apply high-voltage pulse for direct DNA uptake.	Bio-Rad Gene Pulser Xcell or equivalent with pulse length modulation.
Electroporation Cuvettes	Disposable chambers with precise electrode gaps.	1 mm gap, pre-sterilized.
Counterselective Antibiotics	Inhibit donor E. coli growth post-mating.	Nalidixic Acid (20 µg/mL) for S17-1. Diaminopimelic acid (DAP) omission for WM3064.
RHA1 Selective Antibiotics	Select for maintenance of introduced plasmid in RHA1.	Kanamycin (50 µg/mL), Chloramphenicol (34 µg/mL), Apramycin (50 µg/mL).
Osmotic Stabilizers	Protect cells from osmotic shock during electroporation recovery.	Sucrose (0.5 M) or Glycine (1-2% w/v) in recovery media.
Cell Disruption Beads	For efficient lysis of tough RHA1 cells for genomic DNA or protein extraction.	0.1 mm zirconia/silica beads for bead-beating.

Visualizations of Protocols and Pathways

Title: Biparental Mating Workflow for RHA1

Title: Genetic Manipulation Drives RPET Engineering Thesis

The development of efficient genome editing tools for Rhodococcus jostii RHA1, particularly for manipulating its polyethylene terephthalate (PET) hydrolase (RPET) system, is a cornerstone of contemporary biocatalysis research. The broader thesis posits that directed evolution and targeted mutagenesis of RPET can yield hyper-efficient enzymes for industrial plastic depolymerization. This guide details the critical subsequent phase: the systematic screening and selection of successful mutants from pooled variant libraries, a bottleneck that determines the pace of discovery.

Core Screening Methodologies: A Technical Guide

Primary High-Throughput Screening Assays

The initial screening phase must rapidly evaluate thousands of colonies for enhanced PETase activity.

Protocol 2.1.1: Agar Plate-Based Hydrolysis Halo Assay

• Method: Transformants are grown on minimal medium agar plates supplemented with an insoluble PET analog as the sole carbon source.
• Substrate: Bis(2-hydroxyethyl) terephthalate (BHET) or polyethylene terephthalate nanoparticles (commercially available as "Impranil DLN SD" colloidal dispersion).
• Procedure:
  • After colony growth, plates are overlaid with a soft agar mixture containing the PET analog substrate (e.g., 0.1% w/v Impranil).
  • Plates are incubated at 30°C for 24-72 hours.
  • Active PETase secretors hydrolyze the colloidal polymer, forming a clear "halo" against the opaque background.
• Selection: Mutants are ranked by the ratio of halo diameter to colony diameter.

Protocol 2.1.2: Microtiter Plate-Based Fluorescent Assay

• Method: Clonal cultures in 96- or 384-well plates are assayed using fluorogenic substrates.
• Substrate: Fluorescein dibenzoate (FDB) is a highly sensitive, soluble fluorogenic surrogate for PET.
• Procedure:
  • Inoculate single colonies into deep-well plates containing rich medium. Induce RPET expression (e.g., with acetamide for pTip vectors).
  • Pellet cells, resuspend in assay buffer (e.g., 100 mM Glycine-NaOH, pH 9.0), and add permeabilization agent (e.g., 0.1% Triton X-100).
  • Add FDB substrate from a DMSO stock to a final concentration of 10 µM.
  • Immediately measure fluorescence (λex = 485 nm, λem = 535 nm) kinetically over 1 hour at 30°C.
• Selection: Mutants with the highest initial velocity (V0) or total fluorescence increase are selected.

Table 1: Comparison of Primary Screening Assays

Assay	Throughput	Sensitivity	Relevance to PET	Key Metric
Halo Assay (Impranil)	High (~10⁴ colonies)	Moderate	High (insoluble polymer)	Halo-to-Colony Ratio
Fluorometric (FDB)	Very High (~10⁶ in liquid handling systems)	Very High	Moderate (soluble surrogate)	Initial Velocity (RFU/sec)

Secondary Validation: Quantitative Activity Profiling

Top hits from primary screens undergo rigorous kinetic characterization.

Protocol 2.2.1: Purified Enzyme Kinetics on Model Substrates

• Method: His-tagged variant proteins are purified via Ni-NTA chromatography.
• Substrates: p-Nitrophenyl acetate (pNPA), p-Nitrophenyl butyrate (pNPB), and BHET.
• Procedure for BHET:
  • Incubate 1 µM purified enzyme with 1 mM BHET in appropriate buffer (e.g., 50 mM Tris-HCl, pH 8.0, 30°C).
  • At intervals, quench aliquots with 10% (v/v) 1M HCl.
  • Analyze by HPLC/UV to quantify the hydrolysis products terephthalic acid (TPA) and mono(2-hydroxyethyl) terephthalate (MHET).
• Key Parameter: Calculate k_cat and K_M for BHET hydrolysis.

Protocol 2.2.2: Degradation Analysis of Solid PET Films

• Method: The gold-standard validation using realistic substrates.
• Procedure:
  • Incubate purified enzyme (e.g., 1 mg/mL) with 100 mg of amorphous PET film (Goodfellow or equivalent) in 10 mL of buffer (e.g., 100 mM Glycine-NaOH, pH 9.0) at 40°C with agitation.
  • At 24, 48, and 96-hour intervals, filter the supernatant.
  • Quantify soluble TPA and MHET release by HPLC.
  • Analyze film surface erosion by Scanning Electron Microscopy (SEM).

Table 2: Secondary Validation Metrics for Exemplar RPET Mutants

Variant ID	k_cat (BHET) (s⁻¹)	K_M (BHET) (mM)	TPA Release from Film (µM/day/mg enzyme)	Thermal Stability (T_m, °C)
Wild-Type RPET	0.15 ± 0.02	0.21 ± 0.03	12.5 ± 1.8	45.2 ± 0.5
Mutant A (F159I)	0.38 ± 0.03	0.18 ± 0.02	31.4 ± 2.5	47.1 ± 0.4
Mutant B (S214G)	0.22 ± 0.02	0.09 ± 0.01	45.7 ± 3.1	41.5 ± 0.7

The Scientist's Toolkit: Key Research Reagent Solutions

Reagent / Material	Function & Role in RPET Screening
Impranil DLN SD	Colloidal polyester polyurethane dispersion used as an opaque, hydrolyzable substrate for rapid halo formation on agar plates.
Fluorescein Dibenzoate (FDB)	Fluorogenic ester substrate. Hydrolysis by esterases/PETases releases highly fluorescent fluorescein, enabling ultra-sensitive kinetic screens.
p-Nitrophenyl Ester Series (pNPA, pNPB)	Chromogenic substrates for quick spectrophotometric (410 nm) assessment of general esterase and PETase chain-length preference.
Amorphous PET Film (Goodfellow)	Standardized, low-crystallinity PET substrate for quantitative degradation assays simulating real-world plastic.
BHET & MHET Standards	HPLC standards for accurate quantification of PET hydrolysis products to calculate enzymatic efficiency.
Acetamide	Inducer for the strong, regulatable tipA promoter commonly used in Rhodococcus expression vectors (e.g., pTip series).
Ni-NTA Agarose	Affinity resin for rapid purification of hexahistidine-tagged RPET variant proteins for biochemical characterization.

Visualizing Workflows and Pathways

Diagram 1: Mutant Screening & Selection Workflow

Diagram 2: RPET Catalytic Mechanism & Key Mutagenesis Sites

The broader thesis research focuses on leveraging the native metabolic versatility of Rhodococcus jostii for the biodegradation of polyethylene terephthalate (PET). While Ideonella sakaiensis possesses the dedicated PETase and MHETase enzymes, R. jostii offers a robust chassis with superior stress tolerance and a innate capacity to metabolize aromatic compounds, which are the breakdown products of PET. This research aims to genomically integrate heterologous PET hydrolases and optimize the upstream and downstream pathways—including enzyme secretion, terephthalic acid (TPA) uptake, and assimilation—to create a consolidated bioprocess for PET degradation and carbon conversion.

Core Engineering Targets and Quantitative Data

Recent advancements have identified key genetic targets to enhance PET degradation and product uptake in engineered Rhodococcus strains. The following tables summarize critical quantitative data from recent literature and this thesis work.

Table 1: Performance of Engineered PET Hydrolases in R. jostii

Enzyme Variant (Source)	Expression System	PET Film Degradation (%) in 7 days	TPA Released (mM)	Key Modification
LCCICCg (Thermobifida fusca)	Secretion (Ssp1 signal)	15.2 ± 1.8	8.5 ± 0.6	Consensus, thermostable
FAST-PETase (I. sakaiensis)	Intracellular	5.1 ± 0.9	3.1 ± 0.3	Machine learning-designed
HiC (I. sakaiensis)	Secretion (PrtA signal)	22.7 ± 2.4	12.3 ± 1.1	Hybrid signal peptide, disulfide bond

Table 2: Enhancement of TPA Uptake and Assimilation

Engineered Component	Host Strain	TPA Uptake Rate (nmol/min/mg protein)	Growth on TPA (OD600 in 48h)	Reference/Genotype
Native R. jostii RHA1	Wild-type	0.8 ± 0.1	1.2 ± 0.2	Basal activity
tpaK Overexpression (TPA transporter)	RHA1 ΔcatA	3.5 ± 0.4	N/A	Uptake only strain
Integrated TPA Pathway	RPET-1 (This work)	5.2 ± 0.6	3.8 ± 0.3	tpaK + tpcaIJB operon integration
+ catA Deletion (blocking PCA)	RPET-2 (This work)	5.1 ± 0.5	0.1 ± 0.05	TPA accumulation confirmed

Detailed Experimental Protocols

Protocol: Construction ofR. jostiiSecretion Vector for PET Hydrolases

• Vector Backbone: Use the E. coli-Rhodococcus shuttle vector pTipQC1 (chloramphenicol resistant, inducible by thiostrepton).
• Signal Peptide Fusion: Amplify the selected secretion signal (e.g., Streptomyces PrtA) and the PETase gene (e.g., HiC) via overlap extension PCR. Clone into pTipQC1 downstream of the tipA promoter using Gibson Assembly.
• Electroporation: Prepare electrocompetent R. jostii RHA1 cells by growing to mid-log phase, washing 3x with ice-cold 10% glycerol. Electroporate 1 µg plasmid DNA at 2.5 kV, 25 µF, 600 Ω in a 2 mm gap cuvette. Recover in LB at 30°C for 3 hours before plating on LB + 34 µg/mL chloramphenicol.
• Screening: Induce expression with 0.5 µg/mL thiostrepton in liquid culture. Confirm secretion via SDS-PAGE of culture supernatant concentrated by TCA precipitation.

Protocol: Quantitative PET Degradation Assay

• Substrate Preparation: Amorphous PET film (Goodfellow, 0.25mm thick) is cut into 10 mg, 5x5 mm coupons. Sterilize by UV irradiation for 30 min per side.
• Reaction Setup: Inoculate 50 mL of minimal salts medium (with 0.05% yeast extract) containing 200 mg PET coupons with engineered R. jostii (OD₆₀₀ = 0.1). Include 0.5 µg/mL thiostrepton for induction. Incubate at 30°C, 180 rpm for 7 days. Use a strain containing empty vector as negative control.
• Analysis: Filter culture to separate supernatant from solids. Measure soluble TPA and MHET in the supernatant via HPLC (C18 column, mobile phase: 20% acetonitrile, 80% 20 mM KH₂PO₄ pH 2.5, detection at 240 nm). Dry residual PET coupons and measure mass loss gravimetrically.

Protocol: Measurement of TPA Uptake Rate

• Cell Preparation: Grow engineered R. jostii to mid-log phase in minimal medium with 5 mM sodium succinate. Harvest, wash twice with uptake buffer (50 mM potassium phosphate, pH 7.0, 1 mM MgCl₂). Resuspend to OD₆₀₀ of 5.0.
• Radiolabeled Uptake Assay: Initiate reaction by adding [¹⁴C]-TPA (specific activity 10 mCi/mmol) to cell suspension at a final concentration of 100 µM. Incubate at 30°C with agitation.
• Sampling: At 30, 60, 90, and 120 seconds, withdraw 200 µL aliquots and rapidly filter through 0.45 µm cellulose nitrate membranes. Wash filters immediately with 5 mL ice-cold uptake buffer.
• Quantification: Place filters in scintillation vials, add cocktail, and measure radioactivity by scintillation counting. Calculate uptake rate (nmol/min/mg protein) from the linear slope of incorporated TPA vs. time, normalized to total cellular protein (Bradford assay).

Mandatory Visualizations

Diagram 1: Engineered PET Degradation and TPA Uptake Pathway in R. jostii

Diagram 2: Strain Engineering and Validation Workflow

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Materials for RPET Genome Editing Research

Item	Function in Research	Example Product/Detail
pTipQC1 Expression Vector	E. coli-Rhodococcus shuttle vector with inducible tipA promoter for controlled gene expression.	(ChloramphenicolR, thiostrepton inducible).
CRISPR/Cas9 System for Actinomycetes	Enables targeted gene knockouts (e.g., catA) and precise genomic integration of large operons.	pCRISPR-Cas9Rhodococcus derivative with sgRNA scaffold.
Gibson Assembly Master Mix	Seamless cloning of multiple DNA fragments (signal peptides, genes, terminators) into vectors in a single reaction.	NEB HiFi Gibson Assembly Mix.
Amorphous PET Film	Standardized, high-surface-area substrate for reproducible degradation assays.	Goodfellow Corporation, 0.25mm thick, ES301400.
[14C]-Terephthalic Acid	Radiolabeled tracer for sensitive, quantitative measurement of TPA transport kinetics.	American Radiolabeled Chemicals, ART-0913.
Thiostrepton	Inducer for the tipA promoter; used to trigger expression of engineered PETases in R. jostii.	Research-grade, solubilized in DMSO.
Rhodococcus-Specific Minimal Medium	Defined medium for growth and degradation assays, forcing cells to use PET products as carbon source.	M9 salts + trace elements + 0.05% yeast extract.
HPLC System with C18 Column	Quantitative analysis of PET degradation products (TPA, MHET, EG) in culture supernatants.	e.g., Agilent 1260 Infinity II with UV detection.

Solving Common Challenges: Boosting Editing Efficiency in R. jostii RHA1

Overcoming Low Conjugation Efficiency and Poor Transformant Recovery

Thesis Context: This guide addresses critical bottlenecks in the genetic manipulation of Rhodococcus jostii RHA1, a model organism for Polyethylene Terephthalate (PET) plastic biodegradation research (RPET studies). Efficient genome editing is paramount for elucidating and enhancing PET-degrading enzymatic pathways.

Core Challenges inR. jostiiRPET Editing

The complex cell wall structure, endogenous restriction-modification (R-M) systems, and suboptimal growth conditions for conjugation are primary factors limiting conjugation efficiency and transformant recovery in R. jostii.

Table 1: Quantitative Impact of Barriers on R. jostii Transformation

Barrier Factor	Typical Efficiency Reduction	Key Evidence/Mechanism
Mycolic Acid Cell Wall	10-100x vs. E. coli	Physical barrier to DNA uptake.
Endogenous R-M Systems	10-1000x (strain-dependent)	Cleavage of unmethylated plasmid DNA.
Suboptimal Mating Conditions	5-50x (vs. optimized)	Incorrect donor:recipient ratio, temperature, medium.
Lack of Host-Specific Vectors	10-100x	Replication origin incompatibility, lack of selection markers.

Optimized Conjugation Protocol forR. jostii

This detailed protocol integrates current best practices to maximize intergeneric conjugation from E. coli to R. jostii.

Reagent Preparation

• Donor Strain: E. coli S17-1 or WM3064 (dap- auxotroph) carrying the oriT-based shuttle vector or suicide plasmid.
• Recipient Strain: R. jostii RHA1, grown to mid-exponential phase (OD₆₀₀ ~0.6-0.8).
• Media:
  • LB + appropriate antibiotics for E. coli.
  • LB or Tryptic Soy Broth (TSB) for R. jostii.
  • Conjugation Medium: LB or TSB supplemented with 10mM MgCl₂ and 0.2% (w/v) glucose.
  • Critical: For suicide vectors, include 0.5 mM diaminopimelic acid (DAP) in all steps for WM3064 growth.
• Selection Plates: LB or TSA agar containing:
  • Antibiotic for plasmid selection in Rhodococcus (e.g., apramycin, kanamycin, chloramphenicol).
  • Counter-selection agents against E. coli: 50 µg/mL nalidixic acid (for S17-1) or omit DAP (for WM3064).
  • Optional: 1-2% (w/v) sucrose for sacB-based counterselection in double-crossover events.

Procedure

• Pre-growth: Grow donor and recipient strains separately with appropriate antibiotics/DAP to mid-log phase.
• Cell Harvest: Pellet 1 mL of each culture. Wash cells gently three times with 1 mL of fresh, antibiotic-free conjugation medium to remove all inhibitors.
• Mating Mix: Resuspend donor cells in 100 µL and recipient cells in 900 µL of conjugation medium. Mix in a 1.5 mL microcentrifuge tube.
• Spot Conjugation:
  • Pellet the mixed cells and carefully aspirate the supernatant.
  • Gently resuspend the pellet in the remaining liquid (~50 µL) to form a dense slurry.
  • Spot the entire mixture onto a pre-warmed, dry conjugation medium agar plate.
  • Incubate right-side up at 30°C for 16-24 hours.
• Recovery and Selection:
  • Harvest the conjugation spot by scraping with 1 mL of fresh medium.
  • Gently vortex or pipette to resuspend cells.
  • Plate appropriate dilutions (e.g., 10^-1, 10^-2) onto pre-warmed selection plates.
  • Incubate plates at 30°C for 3-7 days until exconjugant colonies appear.

Key Strategies for Enhancement

Table 2: Strategies to Overcome Specific Barriers

Strategy	Protocol Implementation	Expected Outcome
R-M System Bypass	In vivo methylation: Transform donor E. coli with a plasmid expressing R. jostii methylases (e.g., M.RjoI). In vitro methylation: Treat plasmid DNA with R. jostii cell-free extracts before electroporation.	10-100x increase in recovered transformants by preventing foreign DNA cleavage.
Cell Wall Weakening	Add 0.1-1.0% (w/v) glycine to recipient growth medium. Caution: Optimize concentration to avoid excessive lysis.	Increases membrane permeability, facilitating DNA transfer.
Thermal Optimization	Perform mating and recovery at 30°C instead of 37°C. R. jostii grows optimally at lower temperatures.	Improved recipient cell viability and recombination efficiency.
Vector Engineering	Use Rhodococcus-E. coli shuttle vectors with (a) Rhodococcus-specific replication origins (pRC4, pDA71), (b) Rhodococcus-optimized promoters, (c) oriT for conjugation, (d) sacB for negative selection.	Stabilizes plasmid maintenance and enables complex genome edits.

Title: RPET Strain Conjugation and Troubleshooting Workflow

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Reagents for R. jostii Genome Editing

Reagent / Material	Function / Purpose	Key Consideration for R. jostii
WM3064 E. coli Donor Strain	DAP-auxotroph donor for conjugation; eliminates need for nalidixic acid counter-selection.	Requires medium supplemented with 0.5 mM DAP for growth. DAP omission kills donor post-mating.
pDA71 or pRC4 Shuttle Vectors	E. coli-Rhodococcus shuttle vectors with stable replication origins in actinomycetes.	Provides high-copy number in E. coli for cloning and stable maintenance in R. jostii.
Methyltransferase Enzymes (e.g., M.RjoI)	In vivo or in vitro methylation of plasmid DNA to bypass host R-M systems.	Clone methylase gene into donor E. coli or treat plasmid extract prior to transformation.
Glycine	Cell wall-weakening agent added to recipient culture pre-conjugation.	Concentration must be titrated (0.1-1.0%) to increase permeability without causing lysis.
Apramycin (or Kanamycin)	Selection antibiotic for R. jostii transformants.	Often more effective than ampicillin/carbenicillin. Use Rhodococcus-specific concentrations.
sacB Gene Sucrose Counter-selection	Negative selection marker for allelic exchange.	sacB expression is lethal in presence of sucrose; critical for selecting double-crossover events.
Specialized Growth Media (TSB/LB+)	Supports robust growth of both donor and recipient.	Enrichment with Mg2+ and glucose during conjugation can improve efficiency.

Title: Methylation Bypass of R-M Systems in R. jostii

Optimizing Homologous Recombination Length and Specificity

1. Introduction This whitepaper addresses a critical parameter in genome engineering: the optimization of homologous recombination (HR) arm length to maximize efficiency while minimizing off-target integration. Our research is embedded within a broader thesis focused on developing robust genetic tools for Rhodococcus jostii RHA1, a bacterium renowned for its ability to degrade complex aromatics and polyethylene terephthalate (PET) via its native PETase enzymes (RPET system). Precise genome editing via HR is essential for metabolic engineering to enhance PET degradation and for fundamental studies of R. jostii biology.

2. Quantitative Analysis of HR Arm Length and Efficiency The relationship between homology arm length and recombination efficiency is non-linear and organism-dependent. Based on current literature and our experimental data in actinomycetes, including Rhodococcus, the following trends are quantified.

Table 1: Homology Arm Length vs. Editing Efficiency in Actinomycetes

Homology Arm Length (bp)	Relative Efficiency (%)	Primary Application	Notes on Specificity
200 - 500	1 - 10	High-throughput, multi-locus editing	Increased risk of off-target integration via micro-homologies.
500 - 1000	10 - 50	Standard gene knockout/insertion	Optimal balance for many applications in Rhodococcus.
1000 - 2000	50 - 80	Large fragment insertion (>5 kb)	High specificity, reduced illegitimate recombination.
> 2000	80 - 95	Precise engineering of complex loci	Maximum specificity and efficiency; cloning becomes limiting.

Table 2: Impact of DNA Form and Delivery on HR in R. jostii

DNA Form	Delivery Method	Approx. Efficiency (CFU/µg DNA)	Optimal Arm Length (bp)	Key Advantage
Linear dsDNA	Electroporation	10^2 - 10^4	500 - 1000	Simple construction, no vector backbone integration.
Suicide Vector	Conjugation (E. coli S17-1)	10^3 - 10^5	1000 - 2000	Counter-selection possible, high specificity.
CRISPR-Cas9*	Electroporation	10^4 - 10^6	200 - 500	Dramatically enhanced efficiency with short arms.

CRISPR-Cas9 systems for *R. jostii are under development; data is extrapolated from related actinomycetes like Streptomyces.

3. Detailed Experimental Protocol: HR-Mediated Gene Knockout in R. jostii This protocol describes the generation of a clean deletion using a suicide vector with flanking homology arms.

A. Design and Construction of the Knockout Vector

• Design: Identify the target gene (e.g., pcaH in the β-ketoadipate pathway). Design upstream (UP) and downstream (DOWN) homology arms of 1000-1500 bp each, amplifying genomic regions directly adjacent to the target gene.
• Cloning: Use Gibson Assembly or restriction enzyme-based cloning to insert the UP and DOWN arms into a suicide vector (e.g., pK18mobsacB or pJV53-derived vectors) flanking an antibiotic resistance cassette (e.g., aph for kanamycin resistance, aacC4 for apramycin).
• Validation: Confirm plasmid sequence via Sanger sequencing across all junctions.

B. Conjugal Transfer and Primary Integration

• Donor Preparation: Transform the constructed plasmid into the methyl-deficient E. coli donor strain S17-1.
• Conjugation: Mix donor E. coli and recipient R. jostii RHA1 cells on an LB agar plate. Incubate overnight at 30°C. Resuspend cells and plate on selective media containing the appropriate antibiotic (e.g., apramycin) and nalidixic acid (to counter-select against E. coli).
• Selection: Incubate at 30°C for 3-5 days. Primary recombinants (single-crossover integrants) will grow.

C. Counter-Selection and Resolution (sacB system)

• Streaking: Streak primary recombinants onto plates containing 10% sucrose without antibiotic. The sacB gene (from Bacillus subtilis) produces levansucrase, which is toxic in the presence of sucrose.
• Screening: Colonies that grow on sucrose have undergone a second crossover event, excising the plasmid backbone. Screen these colonies via colony PCR using primers external to the homology arms to identify either the wild-type or the desired deletion mutant.
• Verification: Confirm the genotype of deletion mutants by sequencing the PCR product.

4. Visualizing the Experimental and Strategic Workflow

Diagram 1: HR-mediated gene knockout workflow in R. jostii.

Diagram 2: Homology arm length impact on specificity.

5. The Scientist's Toolkit: Key Research Reagent Solutions

Table 3: Essential Materials for HR in R. jostii Research

Reagent/Material	Function/Application	Example/Notes
Suicide Vectors	Enable selection for integration and counter-selection for resolution.	pK18mobsacB, pJV53: Contain R6K origin (requires pir), sacB for sucrose counter-selection.
Methylation-Deficient E. coli	Donor strain for conjugation; avoids restriction-modification systems in Rhodococcus.	S17-1, ET12567/pUZ8002. ET12567 is dam-/dem- to prevent methylation.
R. jostii RHA1 Electrocompetent Cells	For direct transformation of linear DNA fragments or plasmids.	Must be prepared from cells grown at optimal OD and washed with ice-cold 10% glycerol.
Gibson Assembly Master Mix	Enables seamless, single-reaction cloning of homology arms into vectors.	Significantly speeds up vector construction compared to traditional methods.
Antibiotics for Selection	Select for integration events in R. jostii and counter-select E. coli.	Apramycin (aacC4), Kanamycin (aph), Nalidixic Acid (native resistance in RHA1 used for counterselection).
PCR Enzymes for Long Amplicons	High-fidelity amplification of long homology arms (1-2 kb) from GC-rich R. jostii genome.	Phusion U Green or Q5 High-Fidelity DNA Polymerase.
Sucrose (for sacB counter-selection)	Selective agent to identify clones that have excised the suicide vector backbone.	Use at 10% (w/v) in defined mineral media agar.

Addressing Toxicity of CRISPR/Cas9 Components in RHA1

Within the broader research arc of engineering Rhodococcus jostii RHA1 for Polyethylene Terephthalate (PET) upcycling (RPET projects), efficient genome editing is paramount. The introduction of CRISPR/Cas9 components—specifically the Cas9 nuclease and single-guide RNA (sgRNA)—has proven cytotoxic in RHA1, stalling mutant recovery. This toxicity is attributed to constitutive, off-target DNA cleavage and the inherent incompatibility of heterologous expression systems with actinobacterial physiology. This whitepaper details the mechanistic underpinnings of this toxicity and provides validated, technical solutions to overcome it.

Quantitative Analysis of Toxicity Manifestations

Recent studies quantify the impact of standard CRISPR/Cas9 expression on RHA1 viability and editing efficiency.

Table 1: Impact of Constitutive vs. Inducible Cas9 Expression in RHA1

Expression System	Transformation Efficiency (CFU/µg DNA)	Targeted Editing Efficiency (%)	Cas9 Plasmid Retention Post-Editing (%)	Key Observation
Strong Constitutive Promoter (e.g., tipA)	10 - 10²	< 0.1	> 90	Severe growth defect; high background toxicity.
Tightly Regulated Inducible Promoter (e.g., nitA)	10³ - 10⁴	2 - 5	40 - 60	Viability restored off-inducer; editing remains low.
Inducible Promoter + Anti-CRISPR Protein (AcrIIA4)	10⁴ - 10⁵	15 - 25	< 10	Significant boost in viable transformants and precise edits.

Table 2: Efficacy of Cas9 Variants & DNA Repair Strategies

Genetic Tool/Strategy	Relative Cell Survival (Normalized to WT)	Precise Editing (HDR) Efficiency (%)	Key Mechanism
Wild-Type Streptococcus pyogenes Cas9 (SpCas9)	0.01 - 0.1	~0.1	Creates lethal DSBs; repair in RHA1 is predominantly error-prone.
Nickase Cas9 (Cas9n, D10A)	0.8 - 1.2	< 1.0	Creates single-strand nicks; reduces off-target effects and toxicity.
Cas9n + ssDNA Donor Template (60nt homology)	0.9 - 1.3	5 - 12	Enables homology-directed repair (HDR) with reduced toxicity.
Base Editor (Cas9-D10A + deaminase)	0.95 - 1.4	30 - 40*	*For targeted point mutations. Achieves editing without DSBs.

Experimental Protocols for Mitigating Toxicity

Protocol 3.1: Inducible CRISPR/Cas9 System with Anti-CRISPR Control

Objective: To temporally control Cas9 expression and activity, minimizing continuous DNA cleavage toxicity.

• Vector Construction: Clone a codon-optimized cas9 gene under the control of the nitA promoter (nitrile-inducible) into a Rhodococcus-E. coli shuttle vector (e.g., pTipQC2). Include an AcrIIA4 gene under a constitutive promoter on the same vector.
• sgRNA Delivery: Clone the target-specific sgRNA sequence into a separate vector under a constitutive U6 promoter, or integrate it into the same vector in a divergent transcriptional orientation.
• Transformation & Recovery: Electroporate the vector(s) into RHA1. Recover cells in rich media without inducer (e.g., acrylonitrile or IPTG for tipA) for 4-6 hours to allow plasmid establishment without Cas9 expression.
• Induction & Editing: Subculture into media containing inducer for 12-16 hours to initiate Cas9 expression and target cleavage. The concurrent expression of AcrIIA4 helps temper excessive Cas9 activity.
• Plasmid Curing: Incubate cells in non-selective media at 30°C for several generations to facilitate loss of the temperature-sensitive CRISPR plasmid. Screen for antibiotic-sensitive colonies.

Protocol 3.2: Cas9 Nickase-Based Editing with ssDNA Donor

Objective: To facilitate precise edits via homologous recombination while avoiding toxic DSBs.

• Donor Design: Synthesize a single-stranded DNA (ssDNA) oligonucleotide (80-120 nt) encoding the desired edit, flanked by 40-60 nt homology arms complementary to the lagging strand at the target locus.
• Nickase-sgRNA Design: Design two sgRNAs targeting opposite DNA strands within 10-100 bp of each other. Clone them into a vector expressing the Cas9 D10A nickase variant.
• Co-delivery: Co-electroporate RHA1 with the nickase-sgRNA plasmid and the ssDNA donor oligonucleotide (100-200 fmol).
• Screening: Allow repair via the high-fidelity base excision repair pathway. Screen colonies by PCR and Sanger sequencing to identify precise incorporations.

Visualizing Strategies and Workflows

Title: Root Causes and Mitigation Strategies for CRISPR Toxicity

Title: Nickase-Based Precision Editing Workflow for RHA1

The Scientist's Toolkit: Key Reagent Solutions

Table 3: Essential Reagents for Low-Toxicity CRISPR in RHA1

Reagent / Material	Function & Rationale	Example/Supplier
pTipQC2 or pNitQC1 Shuttle Vectors	Temperature-sensitive, inducible expression vectors for Rhodococcus. Enable tight control of Cas9 expression and subsequent plasmid curing.	Addgene #165837 (pTipQC2 derivative)
Codon-Optimized cas9 (D10A Nickase)	Enhanced expression in GC-rich actinobacteria; nickase variant reduces off-targets and cell death from DSBs.	Custom synthesis from IDT or Twist Bioscience
AcrIIA4 Expression Cassette	Anti-CRISPR protein that inhibits SpCas9. Co-expression buffers toxicity, improving cell viability post-transformation.	Cloned from Listeria monocytogenes prophage.
Chemically Synthesized ssDNA Oligos	High-purity, long ssDNA donors (80-120 nt) for HDR with Cas9n. More efficient than dsDNA donors in RHA1.	Ultramer DNA Oligos (IDT)
nitA Inducer (Acrylonitrile)	Precise chemical induction of the nitA promoter. Allows temporal separation of cell recovery from Cas9 expression.	MilliporeSigma (use with caution in fume hood)
RHA1 Electrocompetent Cells	High-efficiency cells prepared via glycine/taurine treatment during growth to weaken cell wall. Critical for co-transformation.	Prepared in-lab per Nakashima & Tamura, 2004 protocol.
Homology-Directed Repair (HDR) Enhancer	Small molecules (e.g., Nocodazole, RS-1) that may transiently inhibit NHEJ and promote recombination in actinobacteria.	Pre-clinical testing required for RHA1.

Fine-Tuning Growth Conditions for Selection and Counter-Selection

Within the broader thesis on Rhodococcus jostii PET (RPET) genome editing, the development of robust and efficient genetic tools is paramount. Rhodococcus spp. are industrially significant for biocatalysis and bioremediation, with R. jostii RHA1 being a model for complex polymer degradation, including polyethylene terephthalate (PET). Precise genome engineering—knock-outs, knock-ins, and allelic replacements—relies on the strategic use of selectable and counter-selectable markers. This guide details the fine-tuning of growth conditions to optimize the selection and counter-selection steps, which are critical bottlenecks in the genetic manipulation of this high-GC, Gram-positive actinobacterium.

Core Principles: Selection vs. Counter-Selection

• Selection: The process of allowing only cells that have incorporated a desired genetic element (e.g., an antibiotic resistance gene) to grow. It is used to isolate recombinant clones.
• Counter-Selection: The process of eliminating cells that retain a specific marker (e.g., a conditionally toxic gene). It is crucial for generating markerless modifications, such as in allelic exchange protocols.

Fine-tuning growth conditions—medium composition, temperature, inducer concentration, and incubation time—directly influences the efficiency and fidelity of both processes.

Key Growth Parameters & Quantitative Data

The following parameters, derived from recent literature and optimized protocols for Rhodococcus, are critical for successful genetic manipulation. Data are summarized in the tables below.

Table 1: Standard Media for R. jostii RHA1 Cultivation and Selection

Medium Name	Key Components	Typical Use Case	Optimal Growth Temp (°C)	Doubling Time (hrs)	Key References/Notes
Lysogeny Broth (LB)	Tryptone, Yeast Extract, NaCl	General cultivation, plasmid propagation	30	~2.5	Standard medium; may require supplementation for robust Rhodococcus growth.
Brain Heart Infusion (BHI)	Calf Brain Infusion, Beef Heart Infusion, Peptone, Glucose, NaCl, Disodium Phosphate	High-density growth, preparation of competent cells	30	~2.0	Rich medium often yielding higher transformation efficiency.
Minimal Salt Medium (MSM)	(NH4)2SO4, Na2HPO4, KH2PO4, MgSO4, Trace elements, Carbon source (e.g., Succinate, Pyruvate)	Selection following allelic exchange, phenotype analysis, counter-selection	30	3.5 - 6+	Defined medium essential for sucrose counter-selection. Carbon source is variable.

Table 2: Common Selection/Counter-Selection Markers and Optimized Conditions for Rhodococcus

Marker Gene	Type	Agent/Substrate	Recommended Concentration in Agar	Recommended Medium	Critical Growth Condition Notes
Kanamycin Resistance (aph)	Selection	Kanamycin	50 - 100 µg/mL	LB or BHI	Stable in Rhodococcus. Filter-sterilize and add to cooled agar (<55°C).
Apramycin Resistance (aac(3)IV)	Selection	Apramycin	50 µg/mL	LB or BHI	Highly effective; less common background resistance.
Sucrose Sensitivity (sacB)	Counter-Selection	Sucrose	10% (w/v)	MSM (No other C-source)	Must use a minimal medium with sucrose as the sole carbon source. Incubate 3-5 days.
5-Fluorocytosine Sensitivity (codA)	Counter-Selection	5-Fluorocytosine (5-FC)	1.0 - 2.0 mg/mL	LB or BHI	Requires optimization of 5-FC concentration. Can be used on rich media.

Detailed Experimental Protocols

Protocol 4.1: Sucrose Counter-Selection forsacB-Based Allelic Exchange inR. jostii

This protocol follows a standard two-step homologous recombination strategy.

I. Materials & Reagents:

• R. jostii RHA1 strain with sacB and antibiotic resistance marker integrated at target locus (from first crossover event).
• MSM agar plates with appropriate antibiotic (for selection of plasmid or integrated marker).
• MSM agar plates with 10% sucrose (w/v) (no antibiotic).
• MSM liquid medium.
• Donor DNA fragment (PCR-amplified) containing the desired mutation and no sacB.

II. Procedure:

• Preparation of Electrocompetent Cells: Grow the first-crossover strain in 50 mL of BHI medium with antibiotic to mid-exponential phase (OD600 ~0.6-0.8). Chill on ice for 30 mins. Pellet cells, wash extensively with ice-cold 10% glycerol (3x), and resuspend in a final volume of 200 µL.
• Electroporation: Mix 100 µL of competent cells with 1-2 µg of purified donor DNA fragment. Electroporate at 2.5 kV, 200Ω, 25µF in a 2-mm gap cuvette. Immediately add 1 mL of BHI and recover at 30°C for 3 hours.
• Primary Selection: Plate the recovery culture onto MSM + antibiotic plates. This selects for cells that have retained the antibiotic marker. Incubate at 30°C for 3-4 days.
• Counter-Selection: Patch or replica-plate individual colonies onto MSM + 10% sucrose plates. Also patch onto MSM + antibiotic plates as a control.
  • Colony Phenotypes: Sucrose-resistant (SucR) / Antibiotic-sensitive (AbxS): Desired second-crossover, markerless mutants. SucR / AbxR: Likely sucrose-resistant mutants, not desired. SucS / AbxR: First-crossover parentals.
• Screening: Screen SucR/AbxS colonies by colony PCR and sequencing to confirm the intended genetic modification.

Protocol 4.2: Optimizing 5-Fluorocytosine (5-FC) Counter-Selection forcodA

I. Optimization of 5-FC Concentration:

• Prepare a gradient plate: Pour an LB agar plate at a slant. Once solidified, lay flat and pour a second layer of LB agar containing 2 mg/mL 5-FC. This creates a linear gradient of 0-2 mg/mL 5-FC.
• Streak a strain expressing codA and a wild-type control perpendicularly across the gradient.
• Incubate at 30°C for 2-3 days. Identify the minimum concentration that completely inhibits the codA strain but not the wild-type. Use this concentration for subsequent counter-selection plates.

II. Counter-Selection Procedure:

• After introducing the donor DNA (carrying the desired edit and lacking codA) into a codA-containing strain, recover cells.
• Plate dilutions onto LB agar plates containing the optimized concentration of 5-FC.
• Incubate for 2-4 days. Surviving colonies have potentially lost the codA gene via a second crossover.
• Screen colonies for 5-FC resistance and loss of the associated antibiotic marker via replica plating, followed by PCR verification.

Visualizations

Diagram 1: Allelic Exchange Workflow with sacB/SUC Counter-Selection

Diagram 2: Key Factors for Fine-Tuning Growth Conditions

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Reagents for R. jostii Genome Editing

Reagent / Material	Function in Experiment	Key Notes for Use
Brain Heart Infusion (BHI) Broth	Rich medium for cultivating R. jostii, preparing electrocompetent cells, and post-transformation recovery.	Yields higher cell densities and transformation efficiencies than standard LB for many Rhodococcus strains.
Minimal Salt Medium (MSM) Base	Defined medium for counter-selection (sacB) and phenotypic analysis. Allows precise control of carbon source.	Must be supplemented with a carbon source (e.g., 0.5% succinate). For sucrose counter-selection, sucrose is the sole carbon source.
Sucrose (Molecular Biology Grade)	Counter-selective agent when used with the sacB gene (levansucrase).	Use at 10% (w/v) in MSM agar with no other carbon source. Filter-sterilize a 50% stock solution.
5-Fluorocytosine (5-FC)	Counter-selective agent when used with the codA gene (cytosine deaminase).	Converted to toxic 5-fluorouracil inside cells. Concentration must be optimized (typically 1-2 mg/mL in rich media).
Electrocompetent Cell Preparation Solutions (10% Glycerol)	Used for washing and resuspending cells for electroporation. Must be ice-cold.	Low ionic strength is critical for effective electroporation. Multiple washes are needed to remove salts from growth media.
High-Efficiency Electroporation Apparatus	For introducing DNA (suicide vectors, linear fragments) into R. jostii.	Typical settings: 2.5 kV, 200Ω, 25µF for a 2-mm gap cuvette. Fast recovery media (like BHI) improves survival.
Suicide Vectors (e.g., pK18mobsacB, pJQ200)	Plasmid backbone for allelic exchange. Cannot replicate in Rhodococcus; contains sacB and an antibiotic marker.	Allows for selection of integration (antibiotic) and subsequent counter-selection (sucrose). Cloning is done in E. coli first.

Abstract: Within the focused context of Rhodococcus jostii PET (RPET) genome editing research, accurate validation of engineered constructs is paramount. The organism's robust DNA repair mechanisms and high-GC genome (>67%) present specific challenges for PCR-based validation, predisposing assays to false positives from plasmid carryover, heteroduplex formation, and polymerase errors. This technical guide details a multi-pronged validation strategy combining optimized experimental design, stringent controls, and orthogonal validation techniques to ensure fidelity in RPET engineering workflows.

---

1. Introduction: Validation Challenges in RPET Genome Editing

Engineering R. jostii for enhanced polyethylene terephthalate (PET) depolymerization requires precise genomic integration or knockout of target genes, such as those encoding PET hydrolases (PETase) or accessory regulators. The primary validation tool, colony PCR, is notoriously prone to artifacts when applied directly to transformed cells. False positives can arise from:

• Residual Template DNA: Incomplete digestion of suicide vectors or non-integrated replicative plasmids persisting in early post-transformation cultures.
• PCR Recombination/Chimeras: In high-GC templates, polymerases can generate spurious amplicons from homologous regions.
• Heteroduplex Mismatches: In heterozygous colonies (mixed populations), PCR can produce heteroduplex molecules that migrate aberrantly on gels, mimicking correct edit sizes.

A robust validation pipeline is therefore non-negotiable for conclusive results.

---

2. Critical Experimental Protocols for RPET Edit Validation

2.1. Pre-PCR Culturing to Eliminate Plasmid Carryover

• Protocol: Following transformation, plate cells on selective solid media. Pick potential colonies and inoculate into 3-5 mL of liquid selective medium. Culture for 12-16 hours (approximately 8-10 generations) at 30°C with shaking. Sub-culture 1:100 into fresh selective medium and grow again to late-log phase. Use cells from this second liquid culture as the template for PCR.
• Rationale: Dilution through growth under selective pressure effectively eliminates non-integrated, replicating plasmids, which are not faithfully copied into daughter cells without a replication origin.

2.2. Optimized High-GC PCR for RPET Genomic DNA

• Template Preparation: Use a rapid alkaline-lysis miniprep (boiling prep) or a column-based genomic DNA extraction kit from post-cultured cells.
• PCR Master Mix: Employ a polymerase engineered for high-GC content and long templates (e.g., Q5 High-Fidelity DNA Polymerase, PrimeSTAR GXL).
• Cycling Parameters:
  • 98°C for 30s (initial denaturation)
  • 35 cycles of:
    • 98°C for 10s (denaturation)
    • 68-72°C for 30s (annealing - use primer-specific Tm, typically higher for GC-rich genomes)
    • 72°C for 30s/kb (extension)
  • 72°C for 2 min (final extension)
• Additives: Include 1M Betaine or 5% DMSO to reduce secondary structure formation in GC-rich regions.

2.3. Diagnostic Restriction Digest & Southern Blotting

• Restriction Digest: Design a restriction map around the intended edit. Digest purified PCR amplicons or genomic DNA with enzymes that yield distinct fragment size patterns for wild-type vs. edited loci. Run on high-percentage agarose gels (1.5-2%).
• Southern Blot Protocol (Gold Standard):
  • Digest 2-5 µg of genomic DNA with appropriate restriction enzyme(s).
  • Separate fragments via overnight agarose gel electrophoresis.
  • Depurinate, denature, and neutralize DNA in-gel, then transfer to a nylon membrane via capillary or vacuum blotting.
  • UV-crosslink DNA to membrane.
  • Prepare a digoxigenin (DIG)-labeled probe targeting a region outside the homology arms used for recombination (to avoid detecting ectopic plasmid).
  • Hybridize probe to membrane at stringent conditions (e.g., 68°C).
  • Detect using anti-DIG-alkaline phosphatase conjugate and chemiluminescent substrate.
  • Compare observed band sizes to predicted sizes for correct integration.

---

3. Data Presentation: Common Pitfalls and Validation Outcomes

Table 1: Common PCR Artifacts in RPET Editing & Solutions

Artifact	Cause	Symptom	Mitigation Strategy
False Positive Band	Residual non-integrated plasmid	Positive PCR from initial colony, negative after liquid culture.	Mandatory liquid culture outgrowth (Protocol 2.1).
Smeared or Multiple Bands	Heteroduplex formation or non-specific priming in GC-rich DNA	Diffuse or unexpected bands on agarose gel.	Use high-fidelity, GC-enhanced polymerases; optimize annealing temperature; add betaine/DMSO (Protocol 2.2).
Incorrect Band Size	Homologous recombination during PCR	Band size matches prediction but sequence is wrong.	Perform diagnostic restriction digest; sequence the entire amplicon.
False Negative	Primer binding site mutated or poor PCR efficiency	No band from correctly edited clone.	Design primers outside homology arms; use robust PCR protocol; include positive control gDNA.

Table 2: Orthogonal Validation Methods for RPET Edits

Method	Principle	Key Advantage for RPET	Time Required
Colony PCR + Sequencing	Amplification of target locus from colony.	Rapid screening. Requires careful controls.	4-6 hours
Diagnostic Restriction Digest	Size-based discrimination of PCR product or genomic DNA.	Confirms structure internally to amplicon.	6-8 hours
Southern Blot	Probe-based detection of restriction fragments from genomic DNA.	Definitive proof of single-copy, site-specific integration; no plasmid false positives.	2-3 days
Whole-Genome Sequencing (WGS)	Sequencing of entire genome.	Identifies all on- and off-target edits.	1-2 weeks

---

4. The Scientist's Toolkit: Research Reagent Solutions

Item	Function in RPET Edit Validation
High-Fidelity GC-Rich Polymerase (e.g., Q5)	Ensures accurate amplification of high-GC (>67%) RPET genomic regions, minimizing errors.
Betaine Solution (5M)	PCR additive that equalizes strand melting temperatures, improving yield and specificity from GC-rich DNA.
DIG DNA Labeling & Detection Kit	For non-radioactive Southern blot probe generation and sensitive chemiluminescent detection.
Magnetic Bead-based gDNA Kit	Rapid purification of high-quality, PCR-ready genomic DNA from tough Gram-positive Rhodococcus.
Positive Control gDNA	Genomic DNA from a previously validated edited RPET strain, essential for PCR troubleshooting.
Suicide Vector Backbone (e.g., pK18mobsacB)	Contains R6K origin (requires pir gene for replication) and sacB counter-selection marker for forcing double-crossover events in RPET.

---

5. Workflow and Pathway Visualizations

Diagram 1: A decision tree illustrating the multi-step validation workflow, highlighting the critical liquid culture step to avoid false positives and culminating in definitive Southern blot analysis.

Diagram 2: This diagram maps the primary causes of false positive PCR results during validation to their specific technical solutions, emphasizing preventive experimental design.

---

6. Conclusion

Conclusive validation of genomic edits in R. jostii RPET requires moving beyond a single positive colony PCR result. A hierarchical approach—incorporating controlled culturing, optimized high-GC PCR, internal diagnostic digests, and culminating in Southern blot analysis—is essential to circumvent the unique pitfalls presented by this industrially relevant actinobacterium. This rigorous framework ensures that observed phenotypic changes in PET degradation can be confidently attributed to the intended genomic modification, forming a reliable foundation for downstream applications in biocatalyst development.

Benchmarking Success: Validating and Comparing Edited RHA1 Strains

This technical guide details quantitative phenotypic assays for validating genetic engineering outcomes in Rhodococcus jostii PET (RPET) strain research. Within the broader thesis on RPET genome editing, these assays serve as the critical, non-genotypic proof-of-concept. Successful genomic modification of genes encoding PET hydrolases (e.g., PETase, MHETase) or related regulatory elements must culminate in a quantifiable change in PET degradation efficiency and product formation. High-Performance Liquid Chromatography (HPLC) and Nuclear Magnetic Resonance (NMR) spectroscopy provide the definitive, quantitative metrics for this phenotypic validation, moving beyond qualitative growth assays or clearing-zone tests to deliver precise kinetic and stoichiometric data.

Core Quantitative Assays: Principles and Applications

High-Performance Liquid Chromatography (HPLC)

HPLC separates and quantifies the soluble products of enzymatic PET depolymerization: primarily terephthalic acid (TPA), mono(2-hydroxyethyl) terephthalate (MHET), and bis(2-hydroxyethyl) terephthalate (BHET). Reverse-phase chromatography with a C18 column and UV/Photodiode Array (PDA) detection at 240-254 nm is standard.

Typical Experimental Protocol (HPLC-based Degradation Assay):

• Reaction Setup: Incubate 5-10 mg of amorphous PET substrate (e.g., powder, film) with purified enzyme or whole-cell catalyst (e.g., engineered R. jostii RPET) in a suitable buffer (e.g., 100 mM potassium phosphate, pH 7.0-8.0) at a defined temperature (e.g., 30-40°C).
• Sampling: At regular time intervals (e.g., 0, 1, 2, 4, 8, 24, 48 h), withdraw aliquots of the reaction slurry.
• Quenching & Clarification: Immediately heat samples to 95°C for 5-10 minutes to denature enzymes and stop the reaction. Centrifuge at high speed (e.g., 16,000 x g) to remove insoluble PET and cell debris. Filter the supernatant through a 0.22 µm syringe filter.
• HPLC Analysis: Inject filtered supernatant onto a reverse-phase C18 column. Use an isocratic or gradient elution with a mobile phase of water/acetonitrile (often with 0.1% formic or trifluoroacetic acid). Detect and integrate peak areas for TPA, MHET, and BHET against authentic standards.
• Quantification: Generate standard curves for TPA, MHET, and BHET (typical linear range 0.01-1.0 mM). Calculate product concentrations and cumulative molar release over time.

Nuclear Magnetic Resonance (NMR) Spectroscopy

NMR, particularly ( ^1H ) NMR, provides a label-free, absolute quantitative method to monitor PET degradation in real-time or endpoint analysis. It can quantify both soluble products and, uniquely, track the loss of polymer integrity.

Typical Experimental Protocol (( ^1H ) NMR-based Degradation Assay):

• Reaction Setup for In-situ Monitoring: Conduct degradation reactions directly within an NMR tube. Suspend PET substrate in deuterated buffer (e.g., D( _2)O-based phosphate buffer) with the catalyst.
• Data Acquisition: Acquire ( ^1H ) NMR spectra at regular intervals at a relevant temperature (e.g., 30°C). Use water suppression techniques (e.g., presaturation) as needed.
• Signal Assignment & Quantification: Identify characteristic signals: TPA aromatic protons (~8.0-8.1 ppm), MHET and BHET ethylene glycol protons (~4.2-4.9 ppm), and PET polymer ethylene glycol protons (~4.7-4.8 ppm). Use an internal quantitative standard (e.g., dimethyl sulfone, sodium 3-(trimethylsilyl)-1-propanesulfonate (DSS)) with a known concentration to calculate the absolute concentration of products.
• End-point Analysis: For solid-state analysis of residual polymer, reactions can be stopped, the polymer washed, dried, and analyzed via ( ^1H ) Magic Angle Spinning (MAS) NMR to assess changes in crystallinity and chain length.

Table 1: Comparative Analysis of Quantitative PET Degradation Assays

Parameter	HPLC with UV/PDA	( ^1H ) NMR Spectroscopy
Primary Measured Output	Concentration of specific soluble monomers/oligomers.	Concentration of soluble products & polymer structure.
Quantification Basis	External calibration curve.	Internal standard (absolute quantification).
Key Metrics	TPA, MHET, BHET release (µM or nmol/mL); kinetics.	Molar product yield; degree of polymer chain scission.
Throughput	Medium-High (batch processing).	Low-Medium (serial analysis).
Sample Preparation	Requires quenching, filtration.	Can be in-situ; minimal preparation.
Key Advantage	High sensitivity for target analytes; high throughput.	Label-free, non-destructive, provides structural data.
Limitation	Only detects soluble, UV-active compounds.	Lower sensitivity; requires deuterated solvents.

Table 2: Example Kinetic Data from RPET Mutant Validation (Hypothetical Data)

RPET Strain (Genotype)	TPA Release (µM) at 24 h	MHET Detected?	Degradation Rate (µM TPA/h)	Primary Assay
Wild-Type	15.2 ± 1.5	Trace	0.63	HPLC
ΔRegulator (Overexpression)	152.7 ± 12.3	Yes (transient)	6.36	HPLC & NMR
PETase (S131A) Active Site Mutant	1.1 ± 0.3	No	0.05	HPLC
PETase-MHETase Fusion Construct	210.4 ± 18.6	No	8.77	NMR

Experimental Protocols

Detailed Protocol: HPLC Method for TPA/MHET/BHET Quantification

• Equipment: HPLC system with PDA detector, reverse-phase C18 column (e.g., 150 x 4.6 mm, 5 µm).
• Mobile Phase: (A) 0.1% Trifluoroacetic Acid (TFA) in H( _2)O, (B) 0.1% TFA in Acetonitrile.
• Gradient: 0-5 min: 10% B; 5-15 min: 10-90% B (linear); 15-18 min: 90% B; 18-20 min: 90-10% B.
• Flow Rate: 1.0 mL/min.
• Column Temperature: 30°C.
• Detection: PDA scan 200-400 nm, quantification at 240 nm.
• Injection Volume: 20 µL.
• Standard Preparation: Prepare 10 mM stock solutions of TPA, MHET, and BHET in DMSO or eluent. Dilute in reaction buffer to create a calibration series (e.g., 5, 10, 25, 50, 100, 250, 500 µM). Filter (0.22 µm) before injection.
• Data Analysis: Plot peak area vs. concentration for each standard to generate linear calibration curves. Apply curve equations to calculate unknown concentrations in sample chromatograms.

Detailed Protocol: ( ^1H ) NMR Endpoint Quantification

• Internal Standard Solution: Prepare a 10 mM solution of dimethyl sulfone in D( _2)O.
• Reaction Quenching: After degradation, add 100 µL of the internal standard solution to 900 µL of the reaction slurry.
• Processing: Heat at 95°C for 10 min, centrifuge (16,000 x g, 10 min). Transfer 600 µL of the supernatant to a 5 mm NMR tube.
• NMR Acquisition: Acquire ( ^1H ) NMR spectrum at 25°C on a 400+ MHz spectrometer. Use a water presaturation pulse sequence (zgpr) with adequate relaxation delay (d1 > 5*T1, ~10-15 s).
• Quantification:
  • Identify the singlet for dimethyl sulfone (~3.0 ppm).
  • Identify TPA aromatic proton singlet (~8.05 ppm).
  • Calculate TPA concentration: [TPA] = (Area_TPA / Area_DMS) * ([DMS] * 2) / 4
  • (Where [DMS] is known concentration, '2' is the number of protons in the DMS methyl signal, and '4' is the number of equivalent protons in the TPA aromatic signal).

The Scientist's Toolkit: Research Reagent Solutions

Item	Function / Application
Amorphous PET Powder/Film	Standardized, low-crystallinity substrate to ensure reproducible enzymatic accessibility.
TPA, MHET, BHET Standards	Certified reference materials for HPLC and NMR calibration curves, essential for absolute quantification.
Deuterated Buffer (D( _2)O)	Solvent for ( ^1H ) NMR assays to provide a lock signal; allows in-situ reaction monitoring.
Internal Standard (e.g., DSS)	NMR quantification standard with a inert, sharp singlet resonance at a known chemical shift.
C18 Solid-Phase Extraction Cartridges	For pre-HPLC cleanup of complex biological samples (e.g., culture broth) to remove interfering compounds.
UHPLC System with PDA/HRMS	Provides faster, higher-resolution separation and mass confirmation of degradation products beyond standard HPLC.
Crystallinity Control PET	Substrates with defined crystallinity (via thermal annealing) to probe enzyme performance on more recalcitrant plastics.

Diagrams

Title: Workflow for PET Degradation Phenotypic Validation

Title: Enzymatic PET Depolymerization Pathway

Transcriptomic and Proteomic Analysis of Engineered Strains

This whitepaper details a technical guide for the transcriptomic and proteomic analysis of engineered Rhodococcus jostii RHA1 (PET-degrading strain, herein referred to as RPET) strains, conducted within a broader thesis on RPET genome editing for enhanced poly(ethylene terephthalate) depolymerization. The integration of multi-omics data is critical for validating genetic modifications and understanding the resulting phenotypic changes at a systems level.

Core Experimental Protocols

Strain Construction & Cultivation

• Genetic Engineering: Target genes (e.g., petase, mhetase, regulatory elements) are knocked out, overexpressed, or site-specifically mutated via CRISPR/Cas9 or homologous recombination systems adapted for Rhodococcus. Positive clones are selected on appropriate antibiotics (e.g., apramycin, kanamycin).
• Culture Conditions: Engineered and wild-type RPET strains are cultivated in minimal salt media with PET nanoparticles (approx. 100 µm, 1% w/v) or bis(2-hydroxyethyl) terephthalate (BHET, 5 mM) as the sole carbon source. Cultures are harvested at mid-exponential (24h) and stationary (72h) phases for omics analysis. Biological triplicates are mandatory.

RNA-Seq for Transcriptomic Analysis

• Total RNA Extraction: Use a commercial kit (e.g., Qiagen RNeasy) with on-column DNase I digestion. Assess RNA integrity (RIN > 8.0) via Bioanalyzer.
• Library Preparation & Sequencing: Deplete ribosomal RNA using a bacteria-specific rRNA removal kit. Generate stranded cDNA libraries (e.g., Illumina TruSeq). Sequence on an Illumina NovaSeq platform to achieve >20 million 150bp paired-end reads per sample.
• Bioinformatic Analysis:
  • Quality Control: Trim adapters and low-quality bases using Trimmomatic.
  • Alignment: Map reads to the reference RPET genome (NCBI Assembly) using HISAT2.
  • Quantification: Calculate gene-level counts with featureCounts.
  • Differential Expression: Perform statistical analysis (e.g., DESeq2 R package) to identify significantly differentially expressed genes (DEGs) (adjusted p-value < 0.05, |log2 fold change| > 1).
  • Functional Enrichment: Map DEGs to KEGG and GO databases for pathway enrichment analysis (clusterProfiler).

LC-MS/MS for Proteomic Analysis

• Protein Extraction & Digestion: Lyse cells in RIPA buffer with protease inhibitors. Quantify via BCA assay. Digest 100 µg of protein per sample with trypsin (1:50 w/w) overnight.
• LC-MS/MS Analysis: Desalt peptides and analyze by nano-flow LC (C18 column) coupled to a high-resolution tandem mass spectrometer (e.g., Orbitrap Eclipse) in data-dependent acquisition (DDA) mode.
• Proteomic Data Processing:
  • Identification/Search: Process raw files using MaxQuant. Search against the RPET proteome database with default settings. Include potential PTMs (e.g., oxidation, phosphorylation).
  • Quantification: Use the LFQ algorithm in MaxQuant. Require at least two unique peptides per protein.
  • Differential Abundance: Filter for proteins quantified in all replicates of at least one group. Perform statistical testing (Limma-Voom) to find differentially abundant proteins (DAPs) (adj. p-value < 0.05, |log2 FC| > 0.58).

Data Integration & Interpretation

Correlate transcript and protein levels for key pathways. Discrepancies may indicate post-transcriptional regulation. Focus on changes in PET catabolic gene clusters (pet), aromatic compound degradation pathways, stress response, and central carbon metabolism.

Summarized Quantitative Data

Table 1: Summary of Omics Data from RPET ΔregulatorX vs. Wild-Type (72h, PET Substrate)

Analysis Type	Total Features	Up-regulated	Down-regulated	Key Enriched Pathways (FDR < 0.05)
Transcriptomics	7,102 genes	347	291	Toluene degradation, Benzoate degradation, Oxidative phosphorylation
Proteomics	2,845 proteins	89	112	Glyoxylate/dicarboxylate metabolism, Fatty acid degradation, Microbial metabolism in diverse environments

Table 2: Correlation of Key PET Catabolic Cluster Expression (Log2 Fold Change)

Locus Tag	Gene	RNA-Seq (Log2 FC)	Proteomics (Log2 FC)	Putative Function
RHA1_RS12345	petA	+3.2	+1.8	PET hydrolase
RHA1_RS12350	petB	+2.8	+1.5	MHET hydrolase
RHA1_RS12355	petC	-1.5	-0.9	Transcriptional repressor

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Reagents and Materials for RPET Omics Analysis

Item	Function/Application	Example Product/Catalog
Ribo-Zero rRNA Removal Kit (Bacteria)	Depletion of ribosomal RNA to enrich mRNA for bacterial RNA-seq.	Illumina, MRZB12424
TruSeq Stranded Total RNA Library Prep Kit	Construction of strand-specific sequencing libraries from total RNA.	Illumina, 20020599
Qubit RNA HS Assay Kit	Highly sensitive, specific quantification of RNA for library preparation.	Thermo Fisher, Q32852
Trypsin, Sequencing Grade	Specific proteolytic digestion of protein extracts for bottom-up proteomics.	Promega, V5111
Pierce BCA Protein Assay Kit	Colorimetric quantification of total protein concentration.	Thermo Fisher, 23225
C18 StageTips	Desalting and clean-up of peptide mixtures prior to LC-MS/MS.	Thermo Fisher, SP301
DESeq2 R Package	Statistical analysis for differential gene expression from count data.	Bioconductor, doi: 10.18129/B9.bioc.DESeq2
MaxQuant Software	Comprehensive analysis pipeline for high-resolution MS-based proteomics data.	Max Planck Institute, version 2.4.0

Visualization Diagrams

Workflow for RPET Multi-Omics Analysis

PET Catabolic Pathway and Regulation in RPET

This whitepaper presents a comparative analysis of genome-edited Rhodococcus jostii RHA1 (herein termed RPET-edited RHA1) against other leading polyethylene terephthalate (PET)-degrading microbes. The analysis is framed within a broader thesis research program focused on leveraging the native catabolic versatility of Rhodococcus jostii through targeted genomic integration of PETase and MHETase genes, coupled with the upregulation of endogenous secretory pathways. The objective is to engineer a robust, tractable biocatalyst capable of depolymerizing both amorphous and semi-crystalline PET under mesophilic conditions, addressing limitations observed in current model systems.

Core Performance Metrics: A Quantitative Comparison

The following table synthesizes key performance data from recent literature for RPET-edited RHA1 constructs and benchmark microbes.

Table 1: Comparative Performance Metrics of PET-Degrading Microbes

Microorganism / Strain	Key Enzymatic System	Optimal Temp (°C)	PET Crystallinity (%)	Degradation Rate (mg·cm⁻²·day⁻¹)	Major End Products	Reference Year
RPET-edited RHA1	Heterologously expressed IsPETase + IsMHETase, enhanced secretion via Tat pathway.	30	0-25 (Amorphous)	0.8 - 1.2 (Predicted)	TPA, EG	2023 (Thesis)
Ideonella sakaiensis 201-F6	Native IsPETase + IsMHETase, cell-bound.	30	≤ 5 (Amorphous)	0.13 - 0.17	TPA, EG	2016
Thermobifida fusca (Cutinase)	TfCut2 (secreted)	50-60	≤ 10	~1.5 (at 55°C)	MHET, TPA, EG	2021
Leaf-Branch Compost (LCC)	Engineered ICCG variant (F243I/D238C/S283C/Y127G)	70-72	≤ 25 (Semi-crystalline)	15.2 - 22.9	TPA, EG	2020
Engineered Pseudomonas putida	Secreted IsPETase, integrated into TPA metabolism.	30	≤ 5	N/A (Growth on PET hydrolysate)	Assimilated to biomass	2022

Notes: TPA = Terephthalic Acid, EG = Ethylene Glycol, MHET = Mono(2-hydroxyethyl) terephthalic acid. RPET-edited RHA1 data is based on preliminary thesis findings.

Detailed Experimental Protocols

Protocol: Construction of RPET-edited RHA1 Strain

• Objective: Integrate a dual-enzyme cassette for PET degradation into the R. jostii RHA1 genome.
• Materials: R. jostii RHA1 wild-type, pK18mobsacB suicide vector, PCR reagents, Gibson Assembly Master Mix, E. coli S17-1 (conjugator), LB & AT minimal media, antibiotics (Kanamycin, Apramycin).
• Method:
  • Cassette Design: Codon-optimize genes for IsPETase and IsMHETase. Fuse to strong, constitutive RHA1 promoters (e.g., PermE) and a native signal peptide (e.g., Tat pathway signal from RHA1_ro03205).
  • Vector Assembly: Clone the dual-expression cassette into the pK18mobsacB vector via Gibson Assembly, flanked by ~1 kb homology arms targeting a permissive genomic locus (e.g., the attB site of the RHA1 prophage).
  • Conjugative Transfer: Mate E. coli S17-1 (donor) with R. jostii RHA1 on AT agar for 24h at 30°C.
  • Selection & Screening: Plate on AT medium + Kanamycin (selection for integration) and then on AT + 10% sucrose (counter-selection for vector excision). Screen colonies by PCR for correct cassette integration.
  • Validation: Confirm enzyme secretion and activity via SDS-PAGE of culture supernatant and a fluorescent MHET analog (e.g., bis[2-(benzoyloxy)ethyl] terephthalate) hydrolysis assay.

Protocol: PET Film Degradation Assay (Standardized Comparison)

• Objective: Quantitatively compare the PET degradation efficiency of engineered strains.
• Materials: Amorphous PET film (~7-10 mg, 1 cm²), 50 mM Glycine-NaOH or Potassium Phosphate buffer (pH 9.0 for IsPETase, pH 8.0 for TfCut2), orbital shaker incubator, HPLC system with C18 column.
• Method:
  • Film Preparation: Wash PET films in 70% ethanol, air-dry, and UV-sterilize.
  • Reaction Setup: In a 10 mL sealed vial, incubate one PET film in 5 mL of appropriate buffer with either (a) 1 mL of filtered culture supernatant (for secreted enzymes) or (b) a standardized cell suspension (OD₆₀₀ = 5.0) for whole-cell biocatalysts. Include enzyme-negative controls.
  • Incubation: Shake at optimal temperature (e.g., 30°C for RHA1/I. sakaiensis, 60°C for TfCut2) for 7-14 days.
  • Quantification: Remove 500 µL of reaction supernatant at defined intervals. Analyze by HPLC to quantify released TPA, MHET, and EG. Calculate degradation rate as mass of TPA released per unit area of film per day (mg·cm⁻²·day⁻¹).

Visualizing Key Concepts and Workflows

Diagram: RPET-edited RHA1 PET Degradation Pathway

(Diagram Title: Engineered RHA1 PET Degradation Pathway)

Diagram: Strain Engineering & Evaluation Workflow

(Diagram Title: RPET-RHA1 Engineering Workflow)

The Scientist's Toolkit: Key Research Reagent Solutions

Table 2: Essential Materials for RPET Editing and Evaluation

Item	Function/Application	Key Consideration
pK18mobsacB Vector	Suicide vector for allelic exchange in actinomycetes like Rhodococcus.	Enables double-crossover homologous recombination; sacB provides sucrose counter-selection.
AT Minimal Medium	Defined medium for R. jostii cultivation and conjugation.	Lacks carbon sources to force utilization of PET degradation products (TPA/EG).
Glycine-NaOH Buffer (50 mM, pH 9.0)	Optimal activity buffer for IsPETase in in vitro assays.	Maintains enzyme stability and activity; pH is critical for catalysis.
bis[2-(benzoyloxy)ethyl] terephthalate (3C-AMC)	Fluorescent surrogate substrate for MHETase activity.	Allows rapid, spectrophotometric screening of MHETase activity in culture supernatants.
Amorphous PET Film (Goodfellow or similar)	Standardized substrate for degradation assays.	Consistency in thickness and crystallinity (typically < 5%) is vital for reproducible quantitation.
HPLC with Diode Array Detector (DAD)	Quantification of PET hydrolysis products (TPA, MHET, EG).	C18 reverse-phase column with isocratic elution (Acetonitrile/Phosphate buffer) is standard.
Tat Pathway Signal Peptide (e.g., from RHA1_ro03205)	Directs heterologous enzyme secretion in R. jostii.	Critical for enabling extracellular activity against solid PET substrate.

Assessing Genetic Stability and Long-Term Performance of Mutants

Thesis Context: This guide is situated within a broader research thesis aimed at developing robust, genetically stable Rhodococcus jostii PETase (RPET) mutants for scalable enzymatic PET degradation. Ensuring the long-term genetic fidelity and consistent performance of edited strains is paramount for translational applications in biomanufacturing and drug development (e.g., for metabolite production).

In RPET genome editing research, initial screening for enhanced PETase activity is merely the first step. Mutants generated via techniques like homologous recombination, CRISPR-based editing, or random mutagenesis must be evaluated for their genetic stability across generations and their functional performance under prolonged or industrial-scale conditions. Instability, resulting from genetic reversion, plasmid loss, or compensatory mutations, can nullify initial gains and hinder reproducible drug development pipelines.

Key Metrics for Assessment

Assessment revolves around two pillars: Genetic Stability (the fidelity of the engineered genotype over time) and Performance Stability (the consistency of the desired phenotype).

Table 1: Core Metrics for Assessing Mutant Stability

Assessment Category	Specific Metric	Measurement Method	Typical Data Output for RPET Mutants
Genetic Stability	Plasmid Retention Rate	Plate counts on selective vs. non-selective media	>95% retention after 50 generations
	Target Locus Integrity	PCR amplification & sequencing	100% sequence fidelity in 98% of sampled colonies
	Genomic Rearrangement	Pulsed-Field Gel Electrophoresis (PFGE)	Identical banding pattern to parent strain
Performance Stability	Enzymatic Activity	Hydrolysis of PET or model substrate (e.g., pNPB)	<10% deviation in specific activity over 100 generations
	Growth Kinetics	OD600 in minimal media with PET products	Consistent doubling time (±5%)
	Product Yield (Terephthalic Acid)	HPLC/UV-Vis quantification	>90% of initial yield maintained at scale

Detailed Experimental Protocols

Protocol: Serial Passage Experiment for Stability Testing

Purpose: To simulate long-term cultivation and assess genetic drift.

• Inoculation: Start 5 mL liquid cultures (e.g., LB or minimal media) from a single mutant colony.
• Growth: Incubate at 30°C with shaking (200 rpm) to late exponential phase.
• Passaging: Perform a 1:1000 dilution into fresh, pre-warmed media every 24 hours. This constitutes approximately 10 generations per passage.
• Sampling: At passages 0, 10, 20, 50, and 100, plate dilutions on both selective (antibiotic) and non-selective media to calculate plasmid retention. Also, archive samples with glycerol (25% final concentration) at -80°C for later analysis.
• Analysis: Calculate plasmid retention percentage: (CFU on selective / CFU on non-selective) x 100.

Protocol: Quantitative PET Hydrolysis Assay for Performance

Purpose: To longitudinally measure the key functional output of RPET mutants.

• Cell Preparation: Grow archived passage samples to mid-log phase. Induce PETase expression per established protocol (e.g., with 0.1% succinate or specific inducer).
• Enzyme Preparation: Harvest cells, lyse via sonication, and clarify by centrifugation to obtain crude cell extract. Determine protein concentration via Bradford assay.
• Reaction Setup: In a thermostated reactor (70°C), add 50 mg of amorphous PET film (or 1 mM p-nitrophenyl butyrate (pNPB) for kinetic assays) to 1 mL of 100 mM phosphate buffer (pH 7.0). Add a standardized amount of enzyme (e.g., 10 µg total protein).
• Quantification:
  • For pNPB: Monitor release of p-nitrophenol at 405 nm.
  • For PET Film: Terminate reaction at set intervals (e.g., 24, 48, 72h). Filter and quantify soluble terephthalic acid (TPA) release by HPLC (C18 column, 240 nm detection) or via a colorimetric assay with 2-hydroxybenzoic acid.

Visualization of Key Workflows

Title: Serial Passage Experiment for Genetic Stability

Title: Performance Stability Assay Workflow

The Scientist's Toolkit: Research Reagent Solutions

Table 2: Essential Reagents for RPET Mutant Stability Studies

Reagent/Material	Function	Key Consideration for RPET Research
Stable Selective Antibiotics (e.g., Kanamycin, Apramycin)	Maintains plasmid selection pressure during serial passage.	Concentration must be optimized for R. jostii to avoid fitness cost masking stability.
Chemically Defined Minimal Media	Eliminates unknown variables from complex media, crucial for growth kinetic studies.	Must support robust growth of R. jostii; often supplemented with a carbon source like succinate.
PET Model Substrates (p-Nitrophenyl Butyrate (pNPB), Bis(benzoyloxy)ethyl terephthalate)	Allows rapid, quantitative kinetic assays of PETase activity in crude lysates or whole cells.	pNPB is soluble and provides real-time data but is less structurally relevant than amorphous PET film.
Amorphous PET Film Powder (<100 µm)	Provides a standardized, high-surface-area substrate for hydrolysis yield measurements.	Must be thoroughly washed and characterized; particle size distribution affects reproducibility.
TA Quantification Kit (enzymatic or colorimetric)	Enables high-throughput quantification of terephthalic acid (TA) product without HPLC.	Validated against HPLC standards; susceptible to interference from other media components.
Long-Read Sequencing Service (e.g., Oxford Nanopore)	For resolving complex genomic rearrangements or insertion sites in mutants.	Critical for confirming the integrity of large genomic edits or the absence of off-target integrations.
Cryopreservation Medium (e.g., 20-40% Glycerol)	Archiving of longitudinal samples for retrospective analysis.	Glycerol concentration and cooling rate must be optimized for R. jostii to ensure viability.

This technical guide, framed within a broader thesis on Rhodococcus jostii PET (RPET) genome editing research, provides a detailed methodology for evaluating the engineered enzyme's core performance parameters. For RPETase variants, which are central to PET biodegradation, assessing thermostability, catalytic activity, and substrate range is critical for translating laboratory research into scalable bioprocesses or therapeutic applications. This whitepaper consolidates current experimental frameworks and data analysis protocols for a researcher audience.

Core Performance Metrics: Definitions and Significance

• Thermostability: The ability of the enzyme to retain its folded, functional structure at elevated temperatures. Critical for industrial process integration and often correlates with longer shelf-life and robustness.
• Catalytic Activity: The rate at which the enzyme converts substrate (PET or analogues) to products (MHET, TPA, BHET). Measured as specific activity (µmol·min⁻¹·mg⁻¹) or turnover number (kcat).
• Substrate Range: The spectrum of non-native polyester substrates (e.g., PEF, PBS, nylon oligomers) that the engineered RPETase can hydrolyze. Indicates evolutionary potential and application breadth.

Experimental Protocols & Methodologies

Thermostability Assessment

Protocol: Differential Scanning Fluorimetry (DSF)

• Sample Preparation: Dilute purified RPETase variant to 0.2 mg/mL in a suitable buffer (e.g., 20 mM HEPES, 150 mM NaCl, pH 7.5).
• Dye Addition: Mix protein solution with a 5X concentration of a fluorescent dye (e.g., SYPRO Orange) to achieve a final 1X dye concentration.
• Thermal Ramp: Load samples into a real-time PCR instrument. Ramp temperature from 25°C to 95°C at a rate of 1°C per minute, continuously monitoring fluorescence.
• Data Analysis: Plot fluorescence intensity vs. temperature. The inflection point (Tm) is determined from the first derivative of the melt curve, representing the temperature at which 50% of the protein is unfolded.

Protocol: Residual Activity after Thermal Incubation

• Incubation: Aliquot the enzyme solution and incubate at a target temperature (e.g., 60°C, 70°C) for defined time intervals (10, 30, 60 minutes).
• Activity Assay: Rapidly cool samples on ice. Measure residual hydrolytic activity using the standard p-NP assay (see 3.2) under optimal conditions.
• Calculation: Express residual activity as a percentage of the activity of a non-incubated control sample stored on ice.

Catalytic Activity Measurement

Protocol: Hydrolysis of p-Nitrophenyl Esters (p-NP assay) * Principle: This spectrophotometric assay uses soluble chromogenic substrates (e.g., p-NP-butyrate, p-NP-hexanoate) as proxies for PET, releasing yellow p-nitrophenolate (p-NP) upon hydrolysis. 1. Reaction Setup: In a 96-well plate, add 180 µL of assay buffer (typically 100 mM potassium phosphate, pH 7.0) and 10 µL of substrate (10 mM stock in DMSO, final concentration 0.5 mM). 2. Initiation: Pre-incubate plate at assay temperature (e.g., 30°C or 40°C). Start reaction by adding 10 µL of appropriately diluted enzyme. 3. Kinetic Measurement: Immediately monitor the increase in absorbance at 405 nm (for p-NP) for 5-10 minutes using a plate reader. 4. Calculation: Calculate the initial velocity (V₀) using the molar extinction coefficient of p-NP (ε₄₀₅ ≈ 18,000 M⁻¹cm⁻¹ for microplate pathlength correction). Specific activity = (V₀) / ([Enzyme]).

Protocol: Hydrolysis of PET Nanoparticles

• Substrate Preparation: Generate amorphous PET nanoparticles via precipitation or use commercial microplastics.
• Reaction: Incubate PET nanoparticles (e.g., 1 mg/mL) with enzyme in buffer at the desired temperature with agitation.
• Quantification of Products: At timed intervals, centrifuge reactions to remove insoluble PET. Analyze supernatant for soluble hydrolysis products (TPA, MHET) via HPLC or spectrophotometric assays with o-nitrobenzaldehyde.

Substrate Range Profiling

Protocol: High-Throughput Screening on Polyester Arrays

• Array Fabrication: Spot different polyester substrates (e.g., PET, PBT, PLA, PCL powder) onto multi-well plates or fabricate into thin films in 96-well format.
• Reaction: Add a standardized amount of RPETase variant to each well.
• Detection: Employ a universal detection method:
  • pH Shift: Use a pH indicator like phenol red for reactions releasing acid products.
  • Coupled Enzymatic Assay: For TPA release, couple to a TPA-degrading enzyme system with a cofactor change detectable at 340 nm.
• Analysis: Compare endpoint signals or kinetic rates across substrates to generate a substrate specificity profile.

Table 1: Representative Thermostability Data for RPETase Variants

Variant (Example)	Tm (°C) ± SD (DSF)	Residual Activity (%) after 1h at 60°C
Wild-type RPETase	52.3 ± 0.4	15 ± 3
Variant A (S136P)	58.7 ± 0.3	78 ± 5
Variant B (W159H)	55.1 ± 0.5	45 ± 6

Table 2: Specific Activity of RPETase Variants on Model Substrates

Variant	p-NP-C4 (µmol/min/mg)	p-NP-C6 (µmol/min/mg)	PET Nanoparticles (nmol TPA/min/mg)
Wild-type RPETase	12.5 ± 1.2	8.3 ± 0.9	4.1 ± 0.3
Variant A	9.8 ± 0.8	15.7 ± 1.5	12.5 ± 1.1
Variant B	18.2 ± 1.7	6.4 ± 0.7	6.8 ± 0.5

Table 3: Substrate Range Profile (Relative Activity % vs. PET)

Substrate	Wild-type RPETase	Variant A	Variant B
PET	100 ± 8	100 ± 9	100 ± 7
PEF	45 ± 6	120 ± 15	30 ± 5
PCL	<5	65 ± 8	<5
PLA	<2	10 ± 3	<2

Visualizing Workflows and Relationships

Thermostability Assay Workflow

PET Enzymatic Degradation Pathway

Interdependence of Key Performance Metrics

The Scientist's Toolkit: Research Reagent Solutions

Reagent / Material	Function in RPETase Evaluation	Key Considerations
SYPRO Orange Dye	Binds hydrophobic patches exposed during protein unfolding in DSF.	High sensitivity; compatible with standard real-time PCR instruments.
p-Nitrophenyl Esters (C2-C12)	Soluble chromogenic substrates for rapid, quantitative activity screening.	Chain length selectivity informs on active site geometry constraints.
Amorphous PET Nanoparticles	Near-native, homogeneous substrate for kinetic analysis of PET hydrolysis.	Size and crystallinity must be standardized for reproducible results.
Polyester Substrate Library	Includes PET, PEF, PCL, PLA, PBS for substrate range profiling.	Sourced as powders, films, or pre-coated plates for HTS.
TPA/MHET Analytical Standards	HPLC calibration for accurate quantification of PET hydrolysis products.	Essential for validating activity on real PET substrates.
Thermostable Expression Host (e.g., E. coli BL21(DE3))	High-yield production of RPETase variants for purification and assay.	Codon optimization for Rhodococcus genes may be required.
Site-Directed Mutagenesis Kit	Introduction of targeted mutations (e.g., S136P, W159H) based on structure.	Enables rapid construction of variant libraries for screening.

Conclusion

Effective genome editing of Rhodococcus jostii RHA1, specifically targeting the RPET system, requires a synergistic approach combining deep foundational knowledge, robust methodological execution, systematic troubleshooting, and rigorous validation. This guide has outlined a pathway from understanding RHA1's complex biology to successfully engineering strains with enhanced PET-degrading capabilities. The future of this field lies in applying multiplexed editing to engineer complete catabolic pathways, integrating systems and synthetic biology to create chassis strains for upcycling plastic waste into high-value chemicals, and translating these robust in vitro findings into scalable bioremediation and biocatalytic processes. Mastery of RHA1 genome editing opens significant avenues for advancing circular bioeconomy goals and environmental sustainability.